Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PRRT2 cdna clone

PRRT2 cDNA Clone

Gene Names
PRRT2; PKC; EKD1; ICCA; BFIC2; BFIS2; DSPB3; DYT10; FICCA; IFITMD1
Synonyms
PRRT2; PRRT2 cDNA Clone; PRRT2 cdna clone
Ordering
For Research Use Only!
Sequence
atggcagccagcagctctgagatctctgagatgaagggggttgaggagagtcccaaggttccaggcgaagggcctggccattctgaagctgaaactggccctccccaggtcctagcaggggtaccagaccagccagaggccccgcagccaggtccaaacaccactgcggcccctgtggactcagggcccaaggctgggctggctccagaaaccacagagaccccggctggggcctcagaaacagcccaggccacagacctcagcttaagcccaggaggggaatcaaaggccaactgcagccccgaagacccatgccaagaaacagtgtccaaaccagaagtgagcaaagaggccactgcagaccaggggtccaggctggagtctgcagccccacctgaaccagccccagagcctgctccccaaccagacccccggccagattcccagccttcccccaagccagcccttcaaccagagctccctacccaggaggaccccacccctgagattctgtctgagagtgtaggggaaaagcaagagaatggggcagtggtgcccctgcaggctggtgatggggaagagggcccagcccctgagcctcactcaccaccctcaaaaaaatcccccccagccaatggggcccccccccgagtgctgcagcagctggttgaggaggatcgaatgagaagggcacacagtgggcatccaggatctccccgaggtagcctgagccgccaccccagctcccagctggcaggtcctggggtggaggggggtgaaggcacccagaaacctcgggactacatcatccttgccatcctgtcctgcttctgccccatgtggcctgtcaacatcgtggccttcgcttatgctgtcatgtcccggaacagcctgcagcagggggacgtggacggggcccagcgtctgggccgggtagccaagctcttaagcatcgtggcgctggtggggggagtcctcatcatcatcgcctcctgcgtcatcaacttaggcgtgtataagtga
Sequence Length
1023
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
30,653 Da
NCBI Official Full Name
Homo sapiens proline-rich transmembrane protein 2, mRNA
NCBI Official Synonym Full Names
proline rich transmembrane protein 2
NCBI Official Symbol
PRRT2
NCBI Official Synonym Symbols
PKC; EKD1; ICCA; BFIC2; BFIS2; DSPB3; DYT10; FICCA; IFITMD1
NCBI Protein Information
proline-rich transmembrane protein 2
UniProt Protein Name
Proline-rich transmembrane protein 2
UniProt Gene Name
PRRT2
UniProt Synonym Gene Names
DSPB3
UniProt Entry Name
PRRT2_HUMAN

NCBI Description

This gene encodes a transmembrane protein containing a proline-rich domain in its N-terminal half. Studies in mice suggest that it is predominantly expressed in brain and spinal cord in embryonic and postnatal stages. Mutations in this gene are associated with episodic kinesigenic dyskinesia-1. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]

Uniprot Description

PRRT2: Defects in PRRT2 are the cause of episodic kinesigenic dyskinesia type 1 (EKD1). An autosomal dominant neurologic condition characterized by recurrent and brief attacks of abnormal involuntary movements, triggered by sudden voluntary movement. These attacks usually have onset during childhood or early adulthood and can involve dystonic postures, chorea, or athetosis. Disease-causing mutations that produce truncation of the C-terminus of the protein alter subcellular location, from plasma membrane to cytosplasm (PubMed:22101681). Defects in PRRT2 are the cause of convulsions, familial infantile, with paroxysmal choreoathetosis (ICCA). A syndrome characterized by clinical features of benign familial infantile seizures and episodic kinesigenic dyskinesia. Benign familial infantile seizures is a disorder characterized by afebrile seizures occurring during the first year of life, without neurologic sequelae. Paroxysmal choreoathetosis is a disorder of involuntary movements characterized by attacks that occur spontaneously or are induced by a variety of stimuli. Defects in PRRT2 are the cause of seizures, benign familial infantile type 2 (BFIS2). An autosomal dominant disorder in which afebrile seizures occur in clusters during the first year of life, without neurologic sequelae. Belongs to the CD225/Dispanin family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 16p11.2

Biological Process: neuromuscular process controlling posture

Disease: Episodic Kinesigenic Dyskinesia 1

Research Articles on PRRT2

Similar Products

Product Notes

The PRRT2 prrt2 (Catalog #AAA1271583) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcagcca gcagctctga gatctctgag atgaaggggg ttgaggagag tcccaaggtt ccaggcgaag ggcctggcca ttctgaagct gaaactggcc ctccccaggt cctagcaggg gtaccagacc agccagaggc cccgcagcca ggtccaaaca ccactgcggc ccctgtggac tcagggccca aggctgggct ggctccagaa accacagaga ccccggctgg ggcctcagaa acagcccagg ccacagacct cagcttaagc ccaggagggg aatcaaaggc caactgcagc cccgaagacc catgccaaga aacagtgtcc aaaccagaag tgagcaaaga ggccactgca gaccaggggt ccaggctgga gtctgcagcc ccacctgaac cagccccaga gcctgctccc caaccagacc cccggccaga ttcccagcct tcccccaagc cagcccttca accagagctc cctacccagg aggaccccac ccctgagatt ctgtctgaga gtgtagggga aaagcaagag aatggggcag tggtgcccct gcaggctggt gatggggaag agggcccagc ccctgagcct cactcaccac cctcaaaaaa atccccccca gccaatgggg cccccccccg agtgctgcag cagctggttg aggaggatcg aatgagaagg gcacacagtg ggcatccagg atctccccga ggtagcctga gccgccaccc cagctcccag ctggcaggtc ctggggtgga ggggggtgaa ggcacccaga aacctcggga ctacatcatc cttgccatcc tgtcctgctt ctgccccatg tggcctgtca acatcgtggc cttcgcttat gctgtcatgt cccggaacag cctgcagcag ggggacgtgg acggggccca gcgtctgggc cgggtagcca agctcttaag catcgtggcg ctggtggggg gagtcctcat catcatcgcc tcctgcgtca tcaacttagg cgtgtataag tga. It is sometimes possible for the material contained within the vial of "PRRT2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.