PPP2R1B cdna clone
PPP2R1B cDNA Clone
Gene Names
PPP2R1B; PR65B; PP2A-Abeta
Synonyms
PPP2R1B; PPP2R1B cDNA Clone; PPP2R1B cdna clone
Sequence
atggcgggcgcatcagagctcgggaccggcccaggagcagcgggtggagatggagatgattcgctatacccgatcgcggttttaatcgacgagctccgcaatgaagacgtgcagctccgactcaacagtattaagaagttatcaacaattgccctagcacttggagtagaaaggacccgaagtgaattgttgccatttcttacagatacaatttatgatgaagatgaggtactattagctcttgctgagcagctgggaaatttcactggcctagtgggaggtcctgactttgcccactgtctgctgcctcctttggaaaatctggcaactgtggaagagactgttgttcgtgacaaggctgtggagtccctgagacagatctcccaggagcatactcctgttgctctggaagcttattttgtacctctggtgaaacgcttagcaagtggggattggttcacctctcgcacatctgcatgtggtttgttcagcgtttgctatcccagggcatcaaatgctgttaaagcagaaatcagacagcaattccgttccttgtgctcagatgacacaccaatggtacgacgtgctgctgcttccaaattgggtgaatttgcaaaagttttggaattagacagtgtgaaaagtgaaattgttccactgttcactagtctagcttcagatgaacaggattcagtgcgcctccttgctgtggaagcttgtgtcagtattgcccagttattgtctcaggatgaccttgagactttggtgatgcctacacttcgacaagcagcagaagataaatcttggcgcgttcgctatatggtggctgacagattttcagagctccagaaagccatgggtcctaaaatcaccctaaatgacctcatccccgcctttcagaacctacttaaagactgtgaagctgaagtccgggctgctgctgcccacaaagtaaaagaacttggtgagaacttgcccattgaagatagagagaccataattatgaatcaaattctgccttatataaaggaattagtatccgataccaatcaacatgtcaaatcggctctagcttctgtaattatgggattgtctactattttgggcaaagaaaataccattgaacatcttctacctcttttcttagctcagttaaaggatgagtgtcctgacgttcgtttgaatatcatctccaatttggattgtgtaaatgaagtgattggaatccgtcagctctctcagtctctccttcctgccatagtggagctggcagaagatgccaaatggagggtccgcctggccatcattgagtatatgccgctgctggcaggccagctgggtgtggaattctttgatgaaaagctgaattctttatgtatggcttggctcgtggaccatgtatacgccatccgagaagctgccaccaacaacctcatgaaactagttcagaagtttggtacagagtgggcccaaaatactattgttcccaaagtgttagtaatggcaaatgatcctaattacttgcatagaatgaccactttattctgcattaatgcactgtctgaggcctgtggtcaggaaataactactaagcaaatgctgcccatcgtattaaaaatggcaggagaccaagtagcaaatgttcgcttcaatgtggccaaatctctacaaaagattggaccaattctagataccaatgctttacagggagaagtgaagccagtactacagaagttaggtcaagatgaagacatggatgtcaaatactttgcacaggaagctataagtgtggtggcacaaaggctgaggaagctagaatttcctgtgaaggacagtggagaacccagtgtccctcgggctgacaagaaccacttcccaagacccacagtgcctggagaggacatggggaagggaccagtgtatcagttgcgtggagatactagagacacacttgcccagctgggaattgcagagctagtgcatttctcccaaagcacagactaa
Sequence Length
2004
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
52,214 Da
NCBI Official Full Name
Homo sapiens protein phosphatase 2 (formerly 2A), regulatory subunit A, beta isoform, mRNA
NCBI Official Synonym Full Names
protein phosphatase 2 scaffold subunit Abeta
NCBI Official Symbol
PPP2R1B
NCBI Official Synonym Symbols
PR65B; PP2A-Abeta
NCBI Protein Information
serine/threonine-protein phosphatase 2A 65 kDa regulatory subunit A beta isoform
UniProt Protein Name
Serine/threonine-protein phosphatase 2A 65 kDa regulatory subunit A beta isoform
UniProt Gene Name
PPP2R1B
UniProt Entry Name
2AAB_HUMAN
NCBI Description
This gene encodes a constant regulatory subunit of protein phosphatase 2. Protein phosphatase 2 is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The constant regulatory subunit A serves as a scaffolding molecule to coordinate the assembly of the catalytic subunit and a variable regulatory B subunit. This gene encodes a beta isoform of the constant regulatory subunit A. Mutations in this gene have been associated with some lung and colon cancers. Alternatively spliced transcript variants have been described. [provided by RefSeq, Apr 2010]
Uniprot Description
PPP2R1B: The PR65 subunit of protein phosphatase 2A serves as a scaffolding molecule to coordinate the assembly of the catalytic subunit and a variable regulatory B subunit. Belongs to the phosphatase 2A regulatory subunit A family. 3 isoforms of the human protein are produced by alternative splicing.
Protein type: Protein phosphatase, regulatory subunit
Chromosomal Location of Human Ortholog: 11q23.2
Cellular Component: lipid raft
Molecular Function: protein binding
Disease: Lung Cancer
Research Articles on PPP2R1B
Similar Products
Product Notes
The PPP2R1B ppp2r1b (Catalog #AAA1272696) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgggcg catcagagct cgggaccggc ccaggagcag cgggtggaga tggagatgat tcgctatacc cgatcgcggt tttaatcgac gagctccgca atgaagacgt gcagctccga ctcaacagta ttaagaagtt atcaacaatt gccctagcac ttggagtaga aaggacccga agtgaattgt tgccatttct tacagataca atttatgatg aagatgaggt actattagct cttgctgagc agctgggaaa tttcactggc ctagtgggag gtcctgactt tgcccactgt ctgctgcctc ctttggaaaa tctggcaact gtggaagaga ctgttgttcg tgacaaggct gtggagtccc tgagacagat ctcccaggag catactcctg ttgctctgga agcttatttt gtacctctgg tgaaacgctt agcaagtggg gattggttca cctctcgcac atctgcatgt ggtttgttca gcgtttgcta tcccagggca tcaaatgctg ttaaagcaga aatcagacag caattccgtt ccttgtgctc agatgacaca ccaatggtac gacgtgctgc tgcttccaaa ttgggtgaat ttgcaaaagt tttggaatta gacagtgtga aaagtgaaat tgttccactg ttcactagtc tagcttcaga tgaacaggat tcagtgcgcc tccttgctgt ggaagcttgt gtcagtattg cccagttatt gtctcaggat gaccttgaga ctttggtgat gcctacactt cgacaagcag cagaagataa atcttggcgc gttcgctata tggtggctga cagattttca gagctccaga aagccatggg tcctaaaatc accctaaatg acctcatccc cgcctttcag aacctactta aagactgtga agctgaagtc cgggctgctg ctgcccacaa agtaaaagaa cttggtgaga acttgcccat tgaagataga gagaccataa ttatgaatca aattctgcct tatataaagg aattagtatc cgataccaat caacatgtca aatcggctct agcttctgta attatgggat tgtctactat tttgggcaaa gaaaatacca ttgaacatct tctacctctt ttcttagctc agttaaagga tgagtgtcct gacgttcgtt tgaatatcat ctccaatttg gattgtgtaa atgaagtgat tggaatccgt cagctctctc agtctctcct tcctgccata gtggagctgg cagaagatgc caaatggagg gtccgcctgg ccatcattga gtatatgccg ctgctggcag gccagctggg tgtggaattc tttgatgaaa agctgaattc tttatgtatg gcttggctcg tggaccatgt atacgccatc cgagaagctg ccaccaacaa cctcatgaaa ctagttcaga agtttggtac agagtgggcc caaaatacta ttgttcccaa agtgttagta atggcaaatg atcctaatta cttgcataga atgaccactt tattctgcat taatgcactg tctgaggcct gtggtcagga aataactact aagcaaatgc tgcccatcgt attaaaaatg gcaggagacc aagtagcaaa tgttcgcttc aatgtggcca aatctctaca aaagattgga ccaattctag ataccaatgc tttacaggga gaagtgaagc cagtactaca gaagttaggt caagatgaag acatggatgt caaatacttt gcacaggaag ctataagtgt ggtggcacaa aggctgagga agctagaatt tcctgtgaag gacagtggag aacccagtgt ccctcgggct gacaagaacc acttcccaag acccacagtg cctggagagg acatggggaa gggaccagtg tatcagttgc gtggagatac tagagacaca cttgcccagc tgggaattgc agagctagtg catttctccc aaagcacaga ctaa. It is sometimes possible for the material contained within the vial of "PPP2R1B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
