Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PPP1R12B cdna clone

PPP1R12B cDNA Clone

Gene Names
PPP1R12B; MYPT2; PP1bp55
Synonyms
PPP1R12B; PPP1R12B cDNA Clone; PPP1R12B cdna clone
Ordering
For Research Use Only!
Sequence
atggcggaactggagcacctaggagggaagcgggcagagtcggcgcgaatgcggcgggcagagcagcttcggcgctggcggggctcgctgacagagcaggagcctgcggagcgacgaggcgcggggcggcagccgctgaccaggcgcgggagccccagggtccgcttcgaggacggtgctgtctttctggccgcctgctctagcggggacaccgacgaggtgagaaagcttctggcaagaggtgctgatatcaacacggtcaacgtggacggcttgacagccctgcaccaggcatgtattgatgaaaatttggacatggtgaagtttctggtggagaacagagccaatgtaaaccagcaagacaacgagggctggacaccccttcatgcagcagcttcctgtggctatctcaacatagcagagtatttcattaatcacggagccagtgtaggtattgtcaatagtgaaggtgaagttccctctgaccttgcagaagagccagccatgaaggatcttcttctggagcaagtaaagaagcaaggagttgatctagagcagtcaagaaaagaagaagagcagcagatgttgcaggatgcccgccagtggctcaacagtgggaaaatagaggatgtgaggcaggctcgctcaggggctacagcccttcatgtggctgctgccaagggctactctgaagtcctcagacttttaattcaggctggctatgaactcaatgttcaggattatgatggctggactcccctccatgctgctgcacactggggagtgaaggaggcttgctccatcctggcagaagcactttgtgacatggatattcgaaataaactgggccagacaccatttgatgtggctgatgagggtctcgtggagcatttggagttgctccagaagaagcagaatgtgcttcgaagtgaaaaggagacacggaataaactcattgagtcagatctgaacagcaagattcagagtgggttctttaagaacaaagagaagatgctctatgaggaggagacacctaagtcccaagaaatggaggaagaaaataaagaatctagtagctccagctcagaggaggaggaaggtgaagatgaagcttctgagtcagaaactgagaaggaggcagttctcttctggcctttttaa
Sequence Length
1161
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
57,501 Da
NCBI Official Full Name
Homo sapiens protein phosphatase 1, regulatory (inhibitor) subunit 12B, mRNA
NCBI Official Synonym Full Names
protein phosphatase 1 regulatory subunit 12B
NCBI Official Symbol
PPP1R12B
NCBI Official Synonym Symbols
MYPT2; PP1bp55
NCBI Protein Information
protein phosphatase 1 regulatory subunit 12B
UniProt Protein Name
Protein phosphatase 1 regulatory subunit 12B
UniProt Gene Name
PPP1R12B
UniProt Synonym Gene Names
MYPT2; Myosin phosphatase target subunit 2
UniProt Entry Name
MYPT2_HUMAN

NCBI Description

Myosin phosphatase is a protein complex comprised of three subunits: a catalytic subunit (PP1c-delta, protein phosphatase 1, catalytic subunit delta), a large regulatory subunit (MYPT, myosin phosphatase target) and small regulatory subunit (sm-M20). Two isoforms of MYPT have been isolated--MYPT1 and MYPT2, the first of which is widely expressed, and the second of which may be specific to heart, skeletal muscle, and brain. Each of the MYPT isoforms functions to bind PP1c-delta and increase phosphatase activity. This locus encodes both MYTP2 and M20. Alternatively spliced transcript variants encoding different isoforms have been identified. Related pseudogenes have been defined on the Y chromosome. [provided by RefSeq, Oct 2011]

Uniprot Description

PPP1R12B: Regulates myosin phosphatase activity. Augments Ca(2+) sensitivity of the contractile apparatus. 5 isoforms of the human protein are produced by alternative promoter.

Protein type: Activator; Protein phosphatase, regulatory subunit; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 1q32.1

Cellular Component: A band; actin cytoskeleton; cytosol; nucleoplasm; plasma membrane; Z disc

Molecular Function: enzyme activator activity; protein binding

Biological Process: G2/M transition of mitotic cell cycle; regulation of muscle contraction

Research Articles on PPP1R12B

Similar Products

Product Notes

The PPP1R12B ppp1r12b (Catalog #AAA1277278) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggaac tggagcacct aggagggaag cgggcagagt cggcgcgaat gcggcgggca gagcagcttc ggcgctggcg gggctcgctg acagagcagg agcctgcgga gcgacgaggc gcggggcggc agccgctgac caggcgcggg agccccaggg tccgcttcga ggacggtgct gtctttctgg ccgcctgctc tagcggggac accgacgagg tgagaaagct tctggcaaga ggtgctgata tcaacacggt caacgtggac ggcttgacag ccctgcacca ggcatgtatt gatgaaaatt tggacatggt gaagtttctg gtggagaaca gagccaatgt aaaccagcaa gacaacgagg gctggacacc ccttcatgca gcagcttcct gtggctatct caacatagca gagtatttca ttaatcacgg agccagtgta ggtattgtca atagtgaagg tgaagttccc tctgaccttg cagaagagcc agccatgaag gatcttcttc tggagcaagt aaagaagcaa ggagttgatc tagagcagtc aagaaaagaa gaagagcagc agatgttgca ggatgcccgc cagtggctca acagtgggaa aatagaggat gtgaggcagg ctcgctcagg ggctacagcc cttcatgtgg ctgctgccaa gggctactct gaagtcctca gacttttaat tcaggctggc tatgaactca atgttcagga ttatgatggc tggactcccc tccatgctgc tgcacactgg ggagtgaagg aggcttgctc catcctggca gaagcacttt gtgacatgga tattcgaaat aaactgggcc agacaccatt tgatgtggct gatgagggtc tcgtggagca tttggagttg ctccagaaga agcagaatgt gcttcgaagt gaaaaggaga cacggaataa actcattgag tcagatctga acagcaagat tcagagtggg ttctttaaga acaaagagaa gatgctctat gaggaggaga cacctaagtc ccaagaaatg gaggaagaaa ataaagaatc tagtagctcc agctcagagg aggaggaagg tgaagatgaa gcttctgagt cagaaactga gaaggaggca gttctcttct ggccttttta a. It is sometimes possible for the material contained within the vial of "PPP1R12B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.