Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PPAP2B cdna clone

PPAP2B cDNA Clone

Gene Names
PLPP3; LPP3; VCIP; Dri42; PAP2B; PPAP2B
Synonyms
PPAP2B; PPAP2B cDNA Clone; PPAP2B cdna clone
Ordering
For Research Use Only!
Sequence
atgcaaaactacaagtacgacaaagcgatcgtcccggagagcaagaacggcggcagcccggcgctcaacaacaacccgaggaggagcggcagcaagcgggtgctgctcatctgcctcgacctcttctgcctcttcatggcgggcctccccttcctcatcatcgagacaagcaccatcaagccttaccaccgagggttttactgcaatgatgagagcatcaagtacccactgaaaactggtgagacaataaatgacgctgtgctctgtgccgtggggatcgtcattgccatcctcgcgatcatcacgggggaattctaccggatctattacctgaagaagtcgcggtcgacgattcagaacccctacgtggcagcactctataagcaagtgggctgcttcctctttggctgtgccatcagccagtctttcacagacattgccaaagtgtccatagggcgcctgcgtcctcacttcttgagtgtctgcaaccctgatttcagccagatcaactgctctgaaggctacattcagaactacagatgcagaggtgatgacagcaaagtccaggaagccaggaagtccttcttctctggccatgcctccttctccatgtacactatgctgtatttggtgctatacctgcaggcccgcttcacttggcgaggagcccgcctgctccggcccctcctgcagttcaccttgatcatgatggccttctacacgggactgtctcgcgtatcagaccacaagcaccatcccagtgatgttctggcaggatttgctcaaggagccctggtggcctgctgcatagttttcttcgtgtctgacctcttcaagactaagatgacgctctccctgcctgcccctgctatccggaaggaaatcctttcacctgtggacattattgacaggaacaatcaccacaacatgatgtag
Sequence Length
936
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
35,116 Da
NCBI Official Full Name
Homo sapiens phosphatidic acid phosphatase type 2B, mRNA
NCBI Official Synonym Full Names
phospholipid phosphatase 3
NCBI Official Symbol
PLPP3
NCBI Official Synonym Symbols
LPP3; VCIP; Dri42; PAP2B; PPAP2B
NCBI Protein Information
phospholipid phosphatase 3
UniProt Protein Name
Phospholipid phosphatase 3
UniProt Gene Name
PLPP3
UniProt Synonym Gene Names
PAP-2b; PAP2b; VCIP
UniProt Entry Name
PLPP3_HUMAN

NCBI Description

The protein encoded by this gene is a member of the phosphatidic acid phosphatase (PAP) family. PAPs convert phosphatidic acid to diacylglycerol, and function in de novo synthesis of glycerolipids as well as in receptor-activated signal transduction mediated by phospholipase D. This protein is a membrane glycoprotein localized at the cell plasma membrane. It has been shown to actively hydrolyze extracellular lysophosphatidic acid and short-chain phosphatidic acid. The expression of this gene is found to be enhanced by epidermal growth factor in Hela cells. [provided by RefSeq, Mar 2010]

Uniprot Description

PPAP2B: Catalyzes the conversion of phosphatidic acid (PA) to diacylglycerol (DG). In addition it hydrolyzes lysophosphatidic acid (LPA), ceramide-1-phosphate (C-1-P) and sphingosine-1- phosphate (S-1-P). The relative catalytic efficiency is LPA = PA > C-1-P > S-1-P. May be involved in cell adhesion and in cell-cell interactions. Belongs to the PA-phosphatase related phosphoesterase family.

Protein type: Motility/polarity/chemotaxis; Phosphatase, lipid; Membrane protein, multi-pass; Lipid Metabolism - ether lipid; EC 3.1.3.4; Membrane protein, integral; Lipid Metabolism - glycerolipid; Lipid Metabolism - glycerophospholipid; Lipid Metabolism - sphingolipid

Chromosomal Location of Human Ortholog: 1p32.2

Cellular Component: adherens junction; Golgi apparatus; integral to plasma membrane; membrane; plasma membrane

Molecular Function: lipid phosphatase activity; phosphoprotein phosphatase activity; protein binding; sphingosine-1-phosphate phosphatase activity

Biological Process: germ cell migration; homotypic cell-cell adhesion; negative regulation of protein amino acid phosphorylation; phospholipid dephosphorylation; phospholipid metabolic process; positive regulation of transcription factor activity; protein stabilization; sphingolipid biosynthetic process

Research Articles on PPAP2B

Similar Products

Product Notes

The PPAP2B plpp3 (Catalog #AAA1273573) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcaaaact acaagtacga caaagcgatc gtcccggaga gcaagaacgg cggcagcccg gcgctcaaca acaacccgag gaggagcggc agcaagcggg tgctgctcat ctgcctcgac ctcttctgcc tcttcatggc gggcctcccc ttcctcatca tcgagacaag caccatcaag ccttaccacc gagggtttta ctgcaatgat gagagcatca agtacccact gaaaactggt gagacaataa atgacgctgt gctctgtgcc gtggggatcg tcattgccat cctcgcgatc atcacggggg aattctaccg gatctattac ctgaagaagt cgcggtcgac gattcagaac ccctacgtgg cagcactcta taagcaagtg ggctgcttcc tctttggctg tgccatcagc cagtctttca cagacattgc caaagtgtcc atagggcgcc tgcgtcctca cttcttgagt gtctgcaacc ctgatttcag ccagatcaac tgctctgaag gctacattca gaactacaga tgcagaggtg atgacagcaa agtccaggaa gccaggaagt ccttcttctc tggccatgcc tccttctcca tgtacactat gctgtatttg gtgctatacc tgcaggcccg cttcacttgg cgaggagccc gcctgctccg gcccctcctg cagttcacct tgatcatgat ggccttctac acgggactgt ctcgcgtatc agaccacaag caccatccca gtgatgttct ggcaggattt gctcaaggag ccctggtggc ctgctgcata gttttcttcg tgtctgacct cttcaagact aagatgacgc tctccctgcc tgcccctgct atccggaagg aaatcctttc acctgtggac attattgaca ggaacaatca ccacaacatg atgtag. It is sometimes possible for the material contained within the vial of "PPAP2B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.