PKD2L1 cdna clone
PKD2L1 cDNA Clone
Gene Names
PKD2L1; PCL; PKDL; PKD2L; TRPP3
Synonyms
PKD2L1; PKD2L1 cDNA Clone; PKD2L1 cdna clone
Sequence
atgaatgctgtgggaagtcctgaggggcaggagctgcaaaagctggggagtggagcctgggacaaccccgcctacagtggtcccccttccccacacgggacgctgagagtctgcaccatctccagcacggggcctctccagccccaacccaagaagcctgaagatgaaccccaggagacggcatacaggacccaggtgtccagctgctgcctccatatctgtcaaggcatcagaggactttggggaacaaccctgactgagaacacagctgagaaccgggaactttatatcaagaccaccctgagggagctgttggtatatattgtgttcctggtggacatctgtctactgacctatggaatgacaagctccagtgcttattactacaccaaagtgatgtctgagctcttcttacatactccatcagacactggagtctcctttcaggccatcagcagcatggcggacttctgggattttgcccagggcccactactggacagtttgtattggaccaaatggtacaacaaccagagcctgggccatggctcccactccttcatctactatgagaacatgctgctgggggttccgaggctgcggcagctaaaggtccgcaatgactcctgtgtggtgcatgaagacttccgggaggacattctgagctgctatgatgtctactctccagacaaagaagaacaactcccctttgggcccttcaatggcacagcgtggacataccactcgcaggatgagttggggggcttctcccactggggcaggctcacaagctacagcggaggtggctactacctggaccttccaggatcccgacagggtagtgcagaggctctccgggcccttcaggaggggctgtggctggacaggggcactcgagtggtgttcatcgacttctcagtctacaatgccaatatcaatcttttctgtgtcctgaggctggtggtggagtttccagctacaggaggtgccatcccatcctggcaaatccgcacagtcaagctgatccgctatgtcagcaactgggacttctttatcgttggctgtgaggtcatcttctgcgtcttcatcttctactatgtggtggaagagatcctggagctccacattcaccggcttcgctacctcagcagcatctggaacatactggacctggtggtcatcttgctctccattgtggctgtgggcttccacatattccgaaccctcgaggtgaatcggctcatggggaagctcctgcagcagccaaacacgtatgcagactttgagttcctcgccttctggcagacacagtacaacaacatgaatgctgtcaacctcttcttcgcctggatcaagatattcaagtacatcagcttcaacaaaaccatgacccagctctcctccacgctggcccgctgtgccaaggacatcctgggcttcgccgtcatgttcttcattgttttcttcgcctatgcccaactcggctacctgcttttcgggacccaagtggaaaactttagcactttcatcaagtgcattttcactcagttccggataatcctcggggactttgactacaatgctatcgacaatgccaaccgcatcctgggccctgcctactttgtcacctatgtcttcttcgtcttcttcgtgctcctgaacatgttcctggccatcatcaatgacacatattcagaggtcaaggaggagctggctggacagaaggatgagctgcaactttctgacctcctgaaacagggctacaacaagaccctactaagactgcgtctgaggaaggagagggtttcggatgtgcagaaggtcctgcagggtggggagcaggagatccagtttgaggatttcaccaacaccttaagggaactgggacacgcagagcatgaaatcactgagctcacggccaccttcaccaagtttgacagagatgggaatcgtattctggatgagaaggaacaggaaaaaatgcgacaggacctggaggaagagagggtggccctcaacactgagattgagaaactaggccgatctattgtgagcagcccacaaggcaaatcgggtccagaggctgccagagcaggaggctgggtttcaggagaagaattctacatgctcacaaggagagttctgcagctggagactgtcctggaaggagtagtgtcccagattgatgctgtaggctcaaagctgaaaatgctggagaggaaggggtggctggctccctccccaggcgtgaaggaacaagctatttggaagcacccgcagccagccccagctgtgaccccagacccctggggagtccagggtgggcaggagagtgaggttccctataaaagagaagaggaagccttagaggagaggagactctcccgtggtgagattccaacgttgcagaggagttaa
Sequence Length
2418
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
88,472 Da
NCBI Official Full Name
Homo sapiens polycystic kidney disease 2-like 1, mRNA
NCBI Official Synonym Full Names
polycystin 2 like 1, transient receptor potential cation channel
NCBI Official Symbol
PKD2L1
NCBI Official Synonym Symbols
PCL; PKDL; PKD2L; TRPP3
NCBI Protein Information
polycystic kidney disease 2-like 1 protein
UniProt Protein Name
Polycystic kidney disease 2-like 1 protein
Protein Family
UniProt Gene Name
PKD2L1
UniProt Synonym Gene Names
PKD2L; PKDL; TRPP3
UniProt Entry Name
PK2L1_HUMAN
NCBI Description
This gene encodes a member of the polycystin protein family. The encoded protein contains multiple transmembrane domains, and cytoplasmic N- and C-termini. The protein may be an integral membrane protein involved in cell-cell/matrix interactions. This protein functions as a calcium-regulated nonselective cation channel. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Uniprot Description
PKD2L1: May function as a subunit of an ion channel and act as a transducer of calcium-mediated signaling. Belongs to the polycystin family. 4 isoforms of the human protein are produced by alternative splicing.
Protein type: Membrane protein, multi-pass; Channel, cation; Motility/polarity/chemotaxis; Membrane protein, integral
Chromosomal Location of Human Ortholog: 10q24
Cellular Component: cell surface; endoplasmic reticulum; intracellular membrane-bound organelle; membrane; nonmotile primary cilium; plasma membrane; receptor complex
Molecular Function: alpha-actinin binding; calcium activated cation channel activity; calcium channel activity; calcium ion binding; calcium-activated potassium channel activity; cation channel activity; cation transmembrane transporter activity; cytoskeletal protein binding; identical protein binding; muscle alpha-actinin binding; protein binding; sodium channel activity; sour taste receptor activity
Biological Process: cation transport; detection of chemical stimulus involved in sensory perception of sour taste; detection of mechanical stimulus; sensory perception of sour taste; smoothened signaling pathway
Research Articles on PKD2L1
Similar Products
Product Notes
The PKD2L1 pkd2l1 (Catalog #AAA1269551) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaatgctg tgggaagtcc tgaggggcag gagctgcaaa agctggggag tggagcctgg gacaaccccg cctacagtgg tcccccttcc ccacacggga cgctgagagt ctgcaccatc tccagcacgg ggcctctcca gccccaaccc aagaagcctg aagatgaacc ccaggagacg gcatacagga cccaggtgtc cagctgctgc ctccatatct gtcaaggcat cagaggactt tggggaacaa ccctgactga gaacacagct gagaaccggg aactttatat caagaccacc ctgagggagc tgttggtata tattgtgttc ctggtggaca tctgtctact gacctatgga atgacaagct ccagtgctta ttactacacc aaagtgatgt ctgagctctt cttacatact ccatcagaca ctggagtctc ctttcaggcc atcagcagca tggcggactt ctgggatttt gcccagggcc cactactgga cagtttgtat tggaccaaat ggtacaacaa ccagagcctg ggccatggct cccactcctt catctactat gagaacatgc tgctgggggt tccgaggctg cggcagctaa aggtccgcaa tgactcctgt gtggtgcatg aagacttccg ggaggacatt ctgagctgct atgatgtcta ctctccagac aaagaagaac aactcccctt tgggcccttc aatggcacag cgtggacata ccactcgcag gatgagttgg ggggcttctc ccactggggc aggctcacaa gctacagcgg aggtggctac tacctggacc ttccaggatc ccgacagggt agtgcagagg ctctccgggc ccttcaggag gggctgtggc tggacagggg cactcgagtg gtgttcatcg acttctcagt ctacaatgcc aatatcaatc ttttctgtgt cctgaggctg gtggtggagt ttccagctac aggaggtgcc atcccatcct ggcaaatccg cacagtcaag ctgatccgct atgtcagcaa ctgggacttc tttatcgttg gctgtgaggt catcttctgc gtcttcatct tctactatgt ggtggaagag atcctggagc tccacattca ccggcttcgc tacctcagca gcatctggaa catactggac ctggtggtca tcttgctctc cattgtggct gtgggcttcc acatattccg aaccctcgag gtgaatcggc tcatggggaa gctcctgcag cagccaaaca cgtatgcaga ctttgagttc ctcgccttct ggcagacaca gtacaacaac atgaatgctg tcaacctctt cttcgcctgg atcaagatat tcaagtacat cagcttcaac aaaaccatga cccagctctc ctccacgctg gcccgctgtg ccaaggacat cctgggcttc gccgtcatgt tcttcattgt tttcttcgcc tatgcccaac tcggctacct gcttttcggg acccaagtgg aaaactttag cactttcatc aagtgcattt tcactcagtt ccggataatc ctcggggact ttgactacaa tgctatcgac aatgccaacc gcatcctggg ccctgcctac tttgtcacct atgtcttctt cgtcttcttc gtgctcctga acatgttcct ggccatcatc aatgacacat attcagaggt caaggaggag ctggctggac agaaggatga gctgcaactt tctgacctcc tgaaacaggg ctacaacaag accctactaa gactgcgtct gaggaaggag agggtttcgg atgtgcagaa ggtcctgcag ggtggggagc aggagatcca gtttgaggat ttcaccaaca ccttaaggga actgggacac gcagagcatg aaatcactga gctcacggcc accttcacca agtttgacag agatgggaat cgtattctgg atgagaagga acaggaaaaa atgcgacagg acctggagga agagagggtg gccctcaaca ctgagattga gaaactaggc cgatctattg tgagcagccc acaaggcaaa tcgggtccag aggctgccag agcaggaggc tgggtttcag gagaagaatt ctacatgctc acaaggagag ttctgcagct ggagactgtc ctggaaggag tagtgtccca gattgatgct gtaggctcaa agctgaaaat gctggagagg aaggggtggc tggctccctc cccaggcgtg aaggaacaag ctatttggaa gcacccgcag ccagccccag ctgtgacccc agacccctgg ggagtccagg gtgggcagga gagtgaggtt ccctataaaa gagaagagga agccttagag gagaggagac tctcccgtgg tgagattcca acgttgcaga ggagttaa. It is sometimes possible for the material contained within the vial of "PKD2L1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
