Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PIGZ cdna clone

PIGZ cDNA Clone

Gene Names
PIGZ; SMP3; PIG-Z; GPI-MT-IV
Synonyms
PIGZ; PIGZ cDNA Clone; PIGZ cdna clone
Ordering
For Research Use Only!
Sequence
atgcagatctgtggatccagcgtagcatctgtagcagctgggacatcattccaggttttgggcccggtgtgttggcaacaactggatctgaagatggcagtcagggtgctttggggtggtctcagcctgctccgagtgctgtggtgtctccttccgcagacgggctatgtgcacccagatgagttcttccagtcccctgaggtgatggcagaggacatcctgggcgttcaggccgcgcggccctgggagttttaccccagcagctcctgccgctcggtgctcttccccctgctgatctccggttccaccttctggctgctcaggctctgggaggagctggggccgtggcctggcctggtgagcggctatgcgctgctggtggggcctcgactcctcctcactgccctttcctttgctctggacggggccgtgtaccacctggccccgccgatgggggcggatcgctggaacgccctggccctgctgtctggttcctacgtcaccctggtcttctacacaaggaccttctccaacaccattgagggactcctcttcacgtggctgctggtgctggtatcctcccatgtaacgtggggccctacacgcaaggagccggcgccgggtccacggtggcgcagctggcttcttggaggcattgtggctgctggcttcttcaaccggcccacctttctggcctttgctgtggtccccctctacctctggggcactcgtggagccacaaaccctggtttgaagtctctgacccgggaggccctggtgctgctccctggggcgaccctcacagcagcggtgtttgtggccacggacagctggtatttctccagccccgctacatccaggaaccttgtcctgacacctgtcaacttcctgcactacaacctgaatccccaaaacctggcgagacatggcacgcacgcgcggctcactcacctggcagtcaacggcttcctgctcttcggggtgctgcatgcccaggccctgcaggctgcgtggcaacagctgcaagtcggcctccaggcctctgcacaaatgggcctcctgagggcactgggtgcccggagcctgctgtccagccccaggtcctatctccttctcctctacttcatgcctctggccctgctatctgcctttagccaccaggaggctcggttcctgattcccctcctggtccccctggtcctgctttgtagtccacagacgcagcctgtgccttggaagggcactgtggtcctcttcaacgccctcggtgccctcctcttcggctgcctgcatcaggggggcctggtgcctggcctggagtacctggagcaggtggtccatgcccctgtgctcccaagcacacccacccactacacactcctcttcactcacacctacatgcccccccggcacctcctacacctcccaggcctgggggcaccagtggaggtggtggacataggggggactgaggactgggccctgtgccaaaccctgaaaagcttcaccagacaaccagcctgccaagtggctggtgggccatggctctgccgcctctttgtggtaacccctggcaccaccaggcgtgccgtggagaagtgcagcttccccttcaagaatgaaacacttttatttccccatctgaccctggaggatccaccagccctgtcctccttgctgagtggggcttggagggaccacctcagtcttcacattgtggagctgggggaagaaacctga
Sequence Length
1740
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
63,471 Da
NCBI Official Full Name
Homo sapiens phosphatidylinositol glycan anchor biosynthesis, class Z, mRNA
NCBI Official Synonym Full Names
phosphatidylinositol glycan anchor biosynthesis class Z
NCBI Official Symbol
PIGZ
NCBI Official Synonym Symbols
SMP3; PIG-Z; GPI-MT-IV
NCBI Protein Information
GPI mannosyltransferase 4
UniProt Protein Name
GPI mannosyltransferase 4
UniProt Gene Name
PIGZ
UniProt Synonym Gene Names
SMP3; GPI-MT-IV; PIG-Z; hSMP3
UniProt Entry Name
PIGZ_HUMAN

NCBI Description

The glycosylphosphatidylinositol (GPI) anchor is a glycolipid found on many blood cells that serves to anchor proteins to the cell surface. This gene encodes a protein that is localized to the endoplasmic reticulum, and is involved in GPI anchor biosynthesis. As shown for the yeast homolog, which is a member of a family of dolichol-phosphate-mannose (Dol-P-Man)-dependent mannosyltransferases, this protein can also add a side-branching fourth mannose to GPI precursors during the assembly of GPI anchors. [provided by RefSeq, Jul 2008]

Uniprot Description

PIGZ: Mannosyltransferase involved in glycosylphosphatidylinositol-anchor biosynthesis. Transfers a fourth mannose to some trimannosyl-GPIs during GPI precursor assembly. The presence of a fourth mannose in GPI is facultative and only scarcely detected, suggesting that it only exists in some tissues. Belongs to the glycosyltransferase 22 family. PIGZ subfamily.

Protein type: Membrane protein, integral; EC 2.4.1.-; Endoplasmic reticulum; Glycan Metabolism - glycosylphosphatidylinositol (GPI)-anchor biosynthesis; Membrane protein, multi-pass; Transferase

Chromosomal Location of Human Ortholog: 3q29

Cellular Component: endoplasmic reticulum

Molecular Function: alpha-1,2-mannosyltransferase activity; mannosyltransferase activity

Biological Process: GPI anchor biosynthetic process

Research Articles on PIGZ

Similar Products

Product Notes

The PIGZ pigz (Catalog #AAA1267119) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcagatct gtggatccag cgtagcatct gtagcagctg ggacatcatt ccaggttttg ggcccggtgt gttggcaaca actggatctg aagatggcag tcagggtgct ttggggtggt ctcagcctgc tccgagtgct gtggtgtctc cttccgcaga cgggctatgt gcacccagat gagttcttcc agtcccctga ggtgatggca gaggacatcc tgggcgttca ggccgcgcgg ccctgggagt tttaccccag cagctcctgc cgctcggtgc tcttccccct gctgatctcc ggttccacct tctggctgct caggctctgg gaggagctgg ggccgtggcc tggcctggtg agcggctatg cgctgctggt ggggcctcga ctcctcctca ctgccctttc ctttgctctg gacggggccg tgtaccacct ggccccgccg atgggggcgg atcgctggaa cgccctggcc ctgctgtctg gttcctacgt caccctggtc ttctacacaa ggaccttctc caacaccatt gagggactcc tcttcacgtg gctgctggtg ctggtatcct cccatgtaac gtggggccct acacgcaagg agccggcgcc gggtccacgg tggcgcagct ggcttcttgg aggcattgtg gctgctggct tcttcaaccg gcccaccttt ctggcctttg ctgtggtccc cctctacctc tggggcactc gtggagccac aaaccctggt ttgaagtctc tgacccggga ggccctggtg ctgctccctg gggcgaccct cacagcagcg gtgtttgtgg ccacggacag ctggtatttc tccagccccg ctacatccag gaaccttgtc ctgacacctg tcaacttcct gcactacaac ctgaatcccc aaaacctggc gagacatggc acgcacgcgc ggctcactca cctggcagtc aacggcttcc tgctcttcgg ggtgctgcat gcccaggccc tgcaggctgc gtggcaacag ctgcaagtcg gcctccaggc ctctgcacaa atgggcctcc tgagggcact gggtgcccgg agcctgctgt ccagccccag gtcctatctc cttctcctct acttcatgcc tctggccctg ctatctgcct ttagccacca ggaggctcgg ttcctgattc ccctcctggt ccccctggtc ctgctttgta gtccacagac gcagcctgtg ccttggaagg gcactgtggt cctcttcaac gccctcggtg ccctcctctt cggctgcctg catcaggggg gcctggtgcc tggcctggag tacctggagc aggtggtcca tgcccctgtg ctcccaagca cacccaccca ctacacactc ctcttcactc acacctacat gcccccccgg cacctcctac acctcccagg cctgggggca ccagtggagg tggtggacat aggggggact gaggactggg ccctgtgcca aaccctgaaa agcttcacca gacaaccagc ctgccaagtg gctggtgggc catggctctg ccgcctcttt gtggtaaccc ctggcaccac caggcgtgcc gtggagaagt gcagcttccc cttcaagaat gaaacacttt tatttcccca tctgaccctg gaggatccac cagccctgtc ctccttgctg agtggggctt ggagggacca cctcagtctt cacattgtgg agctggggga agaaacctga. It is sometimes possible for the material contained within the vial of "PIGZ, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.