Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PIAS2 cdna clone

PIAS2 cDNA Clone

Gene Names
PIAS2; DIP; MIZ; MIZ1; SIZ2; ARIP3; PIASX; ZMIZ4; PIASX-BETA; PIASX-ALPHA
Synonyms
PIAS2; PIAS2 cDNA Clone; PIAS2 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggatttcgaagagttgaggaatatggtttctagttttagggtttctgaactacaagtattactaggctttgctggacggaataaaagtggacgcaagcatgacctcctgatgagggcgctgcatttattgaagagcggctgcagccctgcggttcagattaaaatccgagaattgtatagacgccgatatccacgaactcttgaaggactttctgatttatccacaatcaaatcatcggttttcagtttggatggtggctcatcacctgtagaacctgacttggccgtggctggaatccactcgttgccttccacttcagttacacctcactcaccatcctctcctgttggttctgtgctgcttcaagatactaagcccacatttgagatgcagcagccatctcccccaattcctcctgtccatcctgatgtgcagttaaaaaatctgcccttttatgatgtccttgatgttctcatcaagcccacgagtttagttcaaagcagtattcagcgatttcaagagaagttttttatttttgctttgacacctcaacaagttagagagatatgcatatccagggattttttgccaggtggtaggagagattatacagtccaagttcagttgagactttgcctggcagagacaagttgccctcaagaagataactatccaaatagtctatgtataaaagtaaatgggaagctatttcctttgcctggctatgcaccaccgcctaaaaatgggattgaacagaagcgccctggacgccccttgaatattacatctttagttaggttatcttcagctgtgccaaaccaaatttccatttcttgggcatcagaaattgggaagaattactctatgtctgtatatcttgtacggcagcttacatcagccatgttattacagagattaaaaatgaaaggtattagaaaccctgatcattccagagcactaattaaagaaaaacttactgcagatcctgatagtgaaattgctacaactagccttcgggtatccttgatgtgccctttaggaaaaatgaggctgacaatcccatgccgtgcagtgacttgtacacatctgcagtgttttgatgctgccctctatctacaaatgaatgagaaaaagcccacctggatttgtcctgtgtgtgacaaaaaagctgcctatgaaagtctaatattagatgggctttttatggaaattctcaatgactgttctgatgtagatgagatcaaattccaagaagatggttcttggtgtccaatgagaccgaagaaagaagctatgaaagtatccagccaaccgtgtacaaaaatagaaagttcaagcgtcctcagtaagccttgttcagtgactgtagccagtgaggcaagcaagaagaaagtagatgttattgatcttacaatagaaagctcttctgacgaagaggaagaccctcctgccaaaaggaaatgcatctttatgtcagaaacacaaagcagcccaaccaaaggggttctcatgtatcagccatcttctgtaagggtgcccagtgtgacttcggttgatcctgctgctattccgccttcattaacagactactcagtaccattccaccatacgccaatatcaagcatgtcatcagatttgccaggagaacaaagaagaaatgatattaataatgaactgaagcttggaacatcttctgatactgtgcaacagtga
Sequence Length
1719
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
45,057 Da
NCBI Official Full Name
Homo sapiens protein inhibitor of activated STAT, 2, mRNA
NCBI Official Synonym Full Names
protein inhibitor of activated STAT 2
NCBI Official Symbol
PIAS2
NCBI Official Synonym Symbols
DIP; MIZ; MIZ1; SIZ2; ARIP3; PIASX; ZMIZ4; PIASX-BETA; PIASX-ALPHA
NCBI Protein Information
E3 SUMO-protein ligase PIAS2
UniProt Protein Name
E3 SUMO-protein ligase PIAS2
Protein Family
UniProt Gene Name
PIAS2
UniProt Synonym Gene Names
PIASX; ARIP3; DIP; Miz1
UniProt Entry Name
PIAS2_HUMAN

NCBI Description

This gene encodes a member of the protein inhibitor of activated STAT (PIAS) family. PIAS proteins function as SUMO E3 ligases and play important roles in many cellular processes by mediating the sumoylation of target proteins. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. Isoforms of the encoded protein enhance the sumoylation of specific target proteins including the p53 tumor suppressor protein, c-Jun, and the androgen receptor. A pseudogene of this gene is located on the short arm of chromosome 4. The symbol MIZ1 has also been associated with ZBTB17 which is a different gene located on chromosome 1. [provided by RefSeq, Aug 2011]

Uniprot Description

PIAS2: Functions as an E3-type small ubiquitin-like modifier (SUMO) ligase, stabilizing the interaction between UBE2I and the substrate, and as a SUMO-tethering factor. Plays a crucial role as a transcriptional coregulator in various cellular pathways, including the STAT pathway, the p53 pathway and the steroid hormone signaling pathway. The effects of this transcriptional coregulation, transactivation or silencing may vary depending upon the biological context and the PIAS2 isoform studied. However, it seems to be mostly involved in gene silencing. Binds to sumoylated ELK1 and enhances its transcriptional activity by preventing recruitment of HDAC2 by ELK1, thus reversing SUMO-mediated repression of ELK1 transactivation activity. Isoform PIAS2-beta, but not isoform PIAS2-alpha, promotes MDM2 sumoylation. Isoform PIAS2-alpha promotes PARK7 sumoylation. Isoform PIAS2-beta promotes NCOA2 sumoylation more efficiently than isoform PIAS2- alpha. Belongs to the PIAS family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 6.3.2.-; Nuclear receptor co-regulator; SUMO conjugating system; Transcription, coactivator/corepressor

Chromosomal Location of Human Ortholog: 18q21.1

Cellular Component: nucleoplasm; nucleus; PML body

Molecular Function: protein binding; SUMO ligase activity; transcription factor binding

Biological Process: protein sumoylation

Research Articles on PIAS2

Similar Products

Product Notes

The PIAS2 pias2 (Catalog #AAA1278724) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggatt tcgaagagtt gaggaatatg gtttctagtt ttagggtttc tgaactacaa gtattactag gctttgctgg acggaataaa agtggacgca agcatgacct cctgatgagg gcgctgcatt tattgaagag cggctgcagc cctgcggttc agattaaaat ccgagaattg tatagacgcc gatatccacg aactcttgaa ggactttctg atttatccac aatcaaatca tcggttttca gtttggatgg tggctcatca cctgtagaac ctgacttggc cgtggctgga atccactcgt tgccttccac ttcagttaca cctcactcac catcctctcc tgttggttct gtgctgcttc aagatactaa gcccacattt gagatgcagc agccatctcc cccaattcct cctgtccatc ctgatgtgca gttaaaaaat ctgccctttt atgatgtcct tgatgttctc atcaagccca cgagtttagt tcaaagcagt attcagcgat ttcaagagaa gttttttatt tttgctttga cacctcaaca agttagagag atatgcatat ccagggattt tttgccaggt ggtaggagag attatacagt ccaagttcag ttgagacttt gcctggcaga gacaagttgc cctcaagaag ataactatcc aaatagtcta tgtataaaag taaatgggaa gctatttcct ttgcctggct atgcaccacc gcctaaaaat gggattgaac agaagcgccc tggacgcccc ttgaatatta catctttagt taggttatct tcagctgtgc caaaccaaat ttccatttct tgggcatcag aaattgggaa gaattactct atgtctgtat atcttgtacg gcagcttaca tcagccatgt tattacagag attaaaaatg aaaggtatta gaaaccctga tcattccaga gcactaatta aagaaaaact tactgcagat cctgatagtg aaattgctac aactagcctt cgggtatcct tgatgtgccc tttaggaaaa atgaggctga caatcccatg ccgtgcagtg acttgtacac atctgcagtg ttttgatgct gccctctatc tacaaatgaa tgagaaaaag cccacctgga tttgtcctgt gtgtgacaaa aaagctgcct atgaaagtct aatattagat gggcttttta tggaaattct caatgactgt tctgatgtag atgagatcaa attccaagaa gatggttctt ggtgtccaat gagaccgaag aaagaagcta tgaaagtatc cagccaaccg tgtacaaaaa tagaaagttc aagcgtcctc agtaagcctt gttcagtgac tgtagccagt gaggcaagca agaagaaagt agatgttatt gatcttacaa tagaaagctc ttctgacgaa gaggaagacc ctcctgccaa aaggaaatgc atctttatgt cagaaacaca aagcagccca accaaagggg ttctcatgta tcagccatct tctgtaaggg tgcccagtgt gacttcggtt gatcctgctg ctattccgcc ttcattaaca gactactcag taccattcca ccatacgcca atatcaagca tgtcatcaga tttgccagga gaacaaagaa gaaatgatat taataatgaa ctgaagcttg gaacatcttc tgatactgtg caacagtga. It is sometimes possible for the material contained within the vial of "PIAS2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.