Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PGAM2 cdna clone

PGAM2 cDNA Clone

Gene Names
PGAM2; GSD10; PGAMM; PGAM-M
Synonyms
PGAM2; PGAM2 cDNA Clone; PGAM2 cdna clone
Ordering
For Research Use Only!
Sequence
atggccactcaccgcctcgtgatggtccggcacggcgagagcacatggaaccaggagaaccgtttctgtggctggttcgatgcagagctgagtgaaaaggggaccgaggaggccaagcggggagccaaggccatcaaggatgccaagatggagtttgacatctgctacacgtcagtgctgaagcgggccatccgcaccctctgggccatcctggacggcacggaccagatgtggctgcctgtggtgcgcacttggcgcctcaatgagcggcattacgggggcctcacaggcctcaacaaggcagaaacggccgccaagcacggggaggagcaggtgaagatctggaggcgctccttcgacatcccgccgcccccgatggacgagaagcacccctactacaactccattagcaaggagcgtcggtacgcaggcctgaagcccggggaactccccacctgcgagagcctcaaggacaccattgcccgggccctgcccttctggaacgaggagattgttccccagatcaaggccggcaagcgagtgctcattgcagcccacgggaacagcctgcggggcattgtcaagcacctggaagggatgtcagaccaggcgatcatggagctgaacctgcccacggggatccccattgtgtatgagctgaacaaggagctgaagcccaccaagcccatgcagttcctgggtgatgaggaaacggtgcggaaggccatggaggctgtggctgcccagggcaaggccaagtga
Sequence Length
762
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
28,766 Da
NCBI Official Full Name
Homo sapiens phosphoglycerate mutase 2 (muscle), mRNA
NCBI Official Synonym Full Names
phosphoglycerate mutase 2
NCBI Official Symbol
PGAM2
NCBI Official Synonym Symbols
GSD10; PGAMM; PGAM-M
NCBI Protein Information
phosphoglycerate mutase 2
UniProt Protein Name
Phosphoglycerate mutase 2
Protein Family
UniProt Gene Name
PGAM2
UniProt Synonym Gene Names
PGAMM; PGAM-M
UniProt Entry Name
PGAM2_HUMAN

NCBI Description

Phosphoglycerate mutase (PGAM) catalyzes the reversible reaction of 3-phosphoglycerate (3-PGA) to 2-phosphoglycerate (2-PGA) in the glycolytic pathway. The PGAM is a dimeric enzyme containing, in different tissues, different proportions of a slow-migrating muscle (MM) isozyme, a fast-migrating brain (BB) isozyme, and a hybrid form (MB). This gene encodes muscle-specific PGAM subunit. Mutations in this gene cause muscle phosphoglycerate mutase eficiency, also known as glycogen storage disease X. [provided by RefSeq, Sep 2009]

Uniprot Description

PGAM2: Interconversion of 3- and 2-phosphoglycerate with 2,3- bisphosphoglycerate as the primer of the reaction. Can also catalyze the reaction of EC 5.4.2.4 (synthase) and EC 3.1.3.13 (phosphatase), but with a reduced activity. Defects in PGAM2 are the cause of glycogen storage disease type 10 (GSD10). A metabolic disorder characterized by myoglobinuria, increased serum creatine kinase levels, decreased phosphoglycerate mutase activity, myalgia, muscle pain, muscle cramps and excercise intolerance. Belongs to the phosphoglycerate mutase family. BPG- dependent PGAM subfamily.

Protein type: EC 5.4.2.11; Phosphatase (non-protein); EC 5.4.2.4; Carbohydrate Metabolism - glycolysis and gluconeogenesis; EC 3.1.3.13; Isomerase

Chromosomal Location of Human Ortholog: 7p13-p12

Cellular Component: cytosol; nucleus

Molecular Function: 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase activity; phosphoglycerate mutase activity

Biological Process: gluconeogenesis; glycolysis; regulation of pentose-phosphate shunt; striated muscle contraction

Disease: Glycogen Storage Disease X

Research Articles on PGAM2

Similar Products

Product Notes

The PGAM2 pgam2 (Catalog #AAA1268307) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccactc accgcctcgt gatggtccgg cacggcgaga gcacatggaa ccaggagaac cgtttctgtg gctggttcga tgcagagctg agtgaaaagg ggaccgagga ggccaagcgg ggagccaagg ccatcaagga tgccaagatg gagtttgaca tctgctacac gtcagtgctg aagcgggcca tccgcaccct ctgggccatc ctggacggca cggaccagat gtggctgcct gtggtgcgca cttggcgcct caatgagcgg cattacgggg gcctcacagg cctcaacaag gcagaaacgg ccgccaagca cggggaggag caggtgaaga tctggaggcg ctccttcgac atcccgccgc ccccgatgga cgagaagcac ccctactaca actccattag caaggagcgt cggtacgcag gcctgaagcc cggggaactc cccacctgcg agagcctcaa ggacaccatt gcccgggccc tgcccttctg gaacgaggag attgttcccc agatcaaggc cggcaagcga gtgctcattg cagcccacgg gaacagcctg cggggcattg tcaagcacct ggaagggatg tcagaccagg cgatcatgga gctgaacctg cccacgggga tccccattgt gtatgagctg aacaaggagc tgaagcccac caagcccatg cagttcctgg gtgatgagga aacggtgcgg aaggccatgg aggctgtggc tgcccagggc aaggccaagt ga. It is sometimes possible for the material contained within the vial of "PGAM2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.