Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PDCD5 cdna clone

PDCD5 cDNA Clone

Gene Names
PDCD5; TFAR19
Synonyms
PDCD5; PDCD5 cDNA Clone; PDCD5 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggacgaggagcttgaggcgctgaggagacagaggctggccgagctgcaggccaaacacggggatcctggtgatgcggcccaacaggaagcaaagcacagggaagcagaaatgagaaacagtatcttagcccaagttctggatcagtcggcccgggccaggttaagtaacttagcacttgtaaagcctgaaaaaactaaagcagtagagaattaccttatacagatggcaagatatggacaactaagtgagaaggtatcagaacaaggtttaatagaaatccttaaaaaagtaagccaacaaacagaaaagacaacaacagtgaaattcaacagaagaaaagtaatggactctgatgaagatgacgattattga
Sequence Length
378
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
14,997 Da
NCBI Official Full Name
Homo sapiens programmed cell death 5, mRNA
NCBI Official Synonym Full Names
programmed cell death 5
NCBI Official Symbol
PDCD5
NCBI Official Synonym Symbols
TFAR19
NCBI Protein Information
programmed cell death protein 5
UniProt Protein Name
Programmed cell death protein 5
UniProt Gene Name
PDCD5
UniProt Synonym Gene Names
TFAR19; Protein TFAR19
UniProt Entry Name
PDCD5_HUMAN

NCBI Description

This gene encodes a protein that is upregulated during apoptosis where it translocates rapidly from the cytoplasm to the nucleus. The encoded protein may be an important regulator of K(lysine) acetyltransferase 5 (a protein involved in transcription, DNA damage response and cell cycle control) by inhibiting its proteasome-dependent degradation. Pseudogenes have been identified on chromosomes 5 and 12 [provided by RefSeq, Dec 2010]

Uniprot Description

PDCD5: May function in the process of apoptosis. Belongs to the PDCD5 family.

Protein type: Apoptosis

Chromosomal Location of Human Ortholog: 19q13.11

Cellular Component: cytoplasm; nucleus

Molecular Function: beta-tubulin binding; heparin binding; protein binding

Biological Process: negative regulation of cell proliferation; positive regulation of apoptosis; positive regulation of caspase activity

Research Articles on PDCD5

Similar Products

Product Notes

The PDCD5 pdcd5 (Catalog #AAA1268742) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggacg aggagcttga ggcgctgagg agacagaggc tggccgagct gcaggccaaa cacggggatc ctggtgatgc ggcccaacag gaagcaaagc acagggaagc agaaatgaga aacagtatct tagcccaagt tctggatcag tcggcccggg ccaggttaag taacttagca cttgtaaagc ctgaaaaaac taaagcagta gagaattacc ttatacagat ggcaagatat ggacaactaa gtgagaaggt atcagaacaa ggtttaatag aaatccttaa aaaagtaagc caacaaacag aaaagacaac aacagtgaaa ttcaacagaa gaaaagtaat ggactctgat gaagatgacg attattga. It is sometimes possible for the material contained within the vial of "PDCD5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.