P2RX5 cdna clone
P2RX5 cDNA Clone
Gene Names
P2RX5; P2X5; LRH-1; P2X5R
Synonyms
P2RX5; P2RX5 cDNA Clone; P2RX5 cdna clone
Sequence
atggggcaggcgggctgcaaggggctctgcctgtcgctgttcgactacaagaccgagaagtatgtcatcgccaagaacaagaaggtgggcctgctgtaccggctgctgcaggcctccatcctggcgtacctggtcgtatgggtgttcctgataaagaagggttaccaagacgtcgacacctccctgcagagtgctgtcatcaccaaagtcaagggcgtggccttcaccaacacctcggatcttgggcagcggatctgggatgtcgccgactacgtcattccagcccagggagagaacgtcttttttgtggtcaccaacctgattgtgacccccaaccagcggcagaacgtctgtgctgagaatgaaggcattcctgatggcgcgtgctccaaggacagcgactgccacgctggggaagcggttacagctggaaacggagtgaagaccggccgctgcctgcggagagagaacttggccaggggcacctgtgagatctttgcctggtgcccgttggagacaagctccaggccggaggagccattcctgaaggaggccgaagacttcaccattttcataaagaaccacatccgtttccccaaattcaacttctccaaaagcaatgtgatggacgtcaaggacagatctttcctgaaatcatgccactttggccccaagaaccactactgccccatcttccgactgggctccgtgatccgctgggccgggagcgacttccaggatatagccctggagggtggcgtgataggaattaatattgaatggaactgtgatcttgataaagctgcctctgagtgccaccctcactattcttttagccgtctggacaataaactttcaaagtctgtctcctccgggtacaacttcagatttgccagatattaccgagacgcagccggggtggagttccgcaccctgatgaaagcctacgggatccgctttgacgtgatggtgaacggcaagggtgctttcttctgcgacctggtactcatctacctcatcaaaaagagagagttttaccgtgacaagaagtacgaggaagtgaggggcctagaagacagttcccaggaggccgaggacgaggcatcggggctggggctatctgagcagctcacatctgggccagggctgctggggatgccggagcagcaggagctgcaggagccacccgaggcgaagcgtggaagcagcagtcagaaggggaacggatctgtgtgcccacagctcctggagccccacaggagcacgtga
Sequence Length
1269
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
44,531 Da
NCBI Official Full Name
Homo sapiens purinergic receptor P2X, ligand-gated ion channel, 5, mRNA
NCBI Official Synonym Full Names
purinergic receptor P2X 5
NCBI Official Symbol
P2RX5
NCBI Official Synonym Symbols
P2X5; LRH-1; P2X5R
NCBI Protein Information
P2X purinoceptor 5
UniProt Protein Name
P2X purinoceptor 5
Protein Family
UniProt Gene Name
P2RX5
UniProt Synonym Gene Names
P2X5; P2X5
UniProt Entry Name
P2RX5_HUMAN
NCBI Description
The product of this gene belongs to the family of purinoceptors for ATP. This receptor functions as a ligand-gated ion channel. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the neighboring downstream gene, TAX1BP3 (Tax1 binding protein 3). [provided by RefSeq, Mar 2011]
Uniprot Description
P2X5: Receptor for ATP that acts as a ligand-gated ion channel. Belongs to the P2X receptor family. 4 isoforms of the human protein are produced by alternative splicing.
Protein type: Membrane protein, integral; Membrane protein, multi-pass
Chromosomal Location of Human Ortholog: 17p13.3
Cellular Component: cytoplasm; integral to nuclear inner membrane; plasma membrane
Molecular Function: ATP-gated cation channel activity; ion channel activity; purinergic nucleotide receptor activity; transmembrane receptor activity
Biological Process: blood coagulation; nervous system development; signal transduction; transport
Research Articles on P2RX5
Similar Products
Product Notes
The P2RX5 p2rx5 (Catalog #AAA1273601) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggggcagg cgggctgcaa ggggctctgc ctgtcgctgt tcgactacaa gaccgagaag tatgtcatcg ccaagaacaa gaaggtgggc ctgctgtacc ggctgctgca ggcctccatc ctggcgtacc tggtcgtatg ggtgttcctg ataaagaagg gttaccaaga cgtcgacacc tccctgcaga gtgctgtcat caccaaagtc aagggcgtgg ccttcaccaa cacctcggat cttgggcagc ggatctggga tgtcgccgac tacgtcattc cagcccaggg agagaacgtc ttttttgtgg tcaccaacct gattgtgacc cccaaccagc ggcagaacgt ctgtgctgag aatgaaggca ttcctgatgg cgcgtgctcc aaggacagcg actgccacgc tggggaagcg gttacagctg gaaacggagt gaagaccggc cgctgcctgc ggagagagaa cttggccagg ggcacctgtg agatctttgc ctggtgcccg ttggagacaa gctccaggcc ggaggagcca ttcctgaagg aggccgaaga cttcaccatt ttcataaaga accacatccg tttccccaaa ttcaacttct ccaaaagcaa tgtgatggac gtcaaggaca gatctttcct gaaatcatgc cactttggcc ccaagaacca ctactgcccc atcttccgac tgggctccgt gatccgctgg gccgggagcg acttccagga tatagccctg gagggtggcg tgataggaat taatattgaa tggaactgtg atcttgataa agctgcctct gagtgccacc ctcactattc ttttagccgt ctggacaata aactttcaaa gtctgtctcc tccgggtaca acttcagatt tgccagatat taccgagacg cagccggggt ggagttccgc accctgatga aagcctacgg gatccgcttt gacgtgatgg tgaacggcaa gggtgctttc ttctgcgacc tggtactcat ctacctcatc aaaaagagag agttttaccg tgacaagaag tacgaggaag tgaggggcct agaagacagt tcccaggagg ccgaggacga ggcatcgggg ctggggctat ctgagcagct cacatctggg ccagggctgc tggggatgcc ggagcagcag gagctgcagg agccacccga ggcgaagcgt ggaagcagca gtcagaaggg gaacggatct gtgtgcccac agctcctgga gccccacagg agcacgtga. It is sometimes possible for the material contained within the vial of "P2RX5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
