OLA1 cdna clone
OLA1 cDNA Clone
Gene Names
OLA1; DOC45; GBP45; GTBP9; GTPBP9; PTD004
Synonyms
OLA1; OLA1 cDNA Clone; OLA1 cdna clone
Sequence
atgccccctaaaaagggaggtgatggaattaaaccacccccaatcattggaagatttggaacctcactgaaaattggtattgttggattgccaaatgttgggaaatctactttcttcaatgtgttaaccaatagtcaggcttcagcagaaaacttcccgttctgcactattgatcctaatgagagcagagtacctgtgccagatgaaaggtttgactttctttgtcaataccacaaaccagcaagcaaaattcctgcctttctaaatgtggtggatattgctggccttgtgaaaggagctcacaatgggcagggcctggggaatgcttttttatctcatattagtgcctgtgatggcatctttcatctaacacgtgcttttgaagatgatgatatcacgcacgttgaaggaagtgtagatcctattcgagatatagaaataatacatgaagagcttcagcttaaagatgaggaaatgattgggcccattatagataaactagaaaaggtggctgtgagaggaggagataaaaaactaaaacctgaatatgatataatgtgcaaagtaaaatcctgggttatagatcaaaagaaacctgttcgcttctatcatgattggaatgacaaagagattgaagtgttgaataaacacttatttttgacttcaaaaccaatggtctacttggttaatctttctgaaaaagactacattagaaagaaaaacaaatggttgataaaaattaaagagtgggtggacaagtatgacccaggtgctttggtcattccttttagtggggccttggaactcaagttgcaagaattgagtgctgaggagagacagaagtatctggaagcgaacatgacacaaagtgctttgccaaagatcattaaggctgggtttgcagcactccaactagaatactttttcactgcaggcccagatgaagtgcgtgcatggaccatcaggaaagggactaaggctcctcaggctgcaggaaagattcacacagattttgaaaagggattcattatggctgaagtaatgaaatacgaagattttaaagaggaaggttctgaaaatgcagtcaaggctgctggaaagtacagacaacaaggcagaaattatattgttgaagatggagatattatcttcttcaaatttaacacacctcaacaaccgaagaagaaataa
Sequence Length
1191
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
31,440 Da
NCBI Official Full Name
Homo sapiens Obg-like ATPase 1, mRNA
NCBI Official Synonym Full Names
Obg like ATPase 1
NCBI Official Symbol
OLA1
NCBI Official Synonym Symbols
DOC45; GBP45; GTBP9; GTPBP9; PTD004
NCBI Protein Information
obg-like ATPase 1
UniProt Protein Name
Obg-like ATPase 1
Protein Family
UniProt Gene Name
OLA1
UniProt Synonym Gene Names
DOC45
UniProt Entry Name
OLA1_HUMAN
NCBI Description
This gene encodes a member of the GTPase protein family. The encoded protein interacts with breast cancer-associated gene 1 (BRCA1) and BRCA1-associated RING domain protein (BARD1), and is involved in centrosome regulation. Overexpression of this gene has been observed in multiple types of cancer and may be associated with poor survival. Pseudogenes of this gene have been defined on chromosomes 17 and 22. [provided by RefSeq, Jun 2016]
Uniprot Description
OLA1: Hydrolyzes ATP, and can also hydrolyze GTP with lower efficiency. Has lower affinity for GTP. Belongs to the GTP1/OBG family. 3 isoforms of the human protein are produced by alternative splicing.
Protein type: Hydrolase; Nucleolus; EC 3.6.3.-
Chromosomal Location of Human Ortholog: 2q31.1
Cellular Component: cell-cell adherens junction; centrosome; cytoplasm; membrane
Molecular Function: ATP binding; ATPase activity; protein binding
Biological Process: ATP metabolic process
Research Articles on OLA1
Similar Products
Product Notes
The OLA1 ola1 (Catalog #AAA1277886) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcccccta aaaagggagg tgatggaatt aaaccacccc caatcattgg aagatttgga acctcactga aaattggtat tgttggattg ccaaatgttg ggaaatctac tttcttcaat gtgttaacca atagtcaggc ttcagcagaa aacttcccgt tctgcactat tgatcctaat gagagcagag tacctgtgcc agatgaaagg tttgactttc tttgtcaata ccacaaacca gcaagcaaaa ttcctgcctt tctaaatgtg gtggatattg ctggccttgt gaaaggagct cacaatgggc agggcctggg gaatgctttt ttatctcata ttagtgcctg tgatggcatc tttcatctaa cacgtgcttt tgaagatgat gatatcacgc acgttgaagg aagtgtagat cctattcgag atatagaaat aatacatgaa gagcttcagc ttaaagatga ggaaatgatt gggcccatta tagataaact agaaaaggtg gctgtgagag gaggagataa aaaactaaaa cctgaatatg atataatgtg caaagtaaaa tcctgggtta tagatcaaaa gaaacctgtt cgcttctatc atgattggaa tgacaaagag attgaagtgt tgaataaaca cttatttttg acttcaaaac caatggtcta cttggttaat ctttctgaaa aagactacat tagaaagaaa aacaaatggt tgataaaaat taaagagtgg gtggacaagt atgacccagg tgctttggtc attcctttta gtggggcctt ggaactcaag ttgcaagaat tgagtgctga ggagagacag aagtatctgg aagcgaacat gacacaaagt gctttgccaa agatcattaa ggctgggttt gcagcactcc aactagaata ctttttcact gcaggcccag atgaagtgcg tgcatggacc atcaggaaag ggactaaggc tcctcaggct gcaggaaaga ttcacacaga ttttgaaaag ggattcatta tggctgaagt aatgaaatac gaagatttta aagaggaagg ttctgaaaat gcagtcaagg ctgctggaaa gtacagacaa caaggcagaa attatattgt tgaagatgga gatattatct tcttcaaatt taacacacct caacaaccga agaagaaata a. It is sometimes possible for the material contained within the vial of "OLA1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
