Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NUTF2 cdna clone

NUTF2

Synonyms
NUTF2; NTF2; PP15; NUTF2 cdna clone
Ordering
For Research Use Only!
Form/Format
Lyophilized
Sequence
Nucleotide Sequence: ATGGGAGACAAGCCAATTTGGGAGCAGATTGGATCCAGCTTCATTCAACATTACTACCAGTTATTTGATAATGATAGAACCCAACTAGGCGCAATTTACATTGACGCGTCATGCCTTACGTGGGAAGGACAACAGTTCCAGGGGAAAGCTGCCATTGTGGAGAAGTTGTCTAGCCTTCCGTTCCAGAAAATTCAGCACAGCATCACCGCGCAGGACCATCAGCCCACTCCAGATAGCTGCATCATCAGCATGGTTGTGGGCCAGCTTAAGGCGGATGAAGACCCCATCATGGGGTTCCACCAGATGTTCCTATTAAAGAACATCAACGATGCTTGGGTTTGCACCAATGACATGTTCAGGCTCGCCCTGCACAACTTTGGCTGA

Translation Sequence: MGDKPIWEQI GSSFIQHYYQ LFDNDRTQLG AIYIDASCLT WEGQQFQGKA AIVEKLSSLP FQKIQHSITA QDHQPTPDSC IISMVVGQLK ADEDPIMGFH QMFLLKNIND AWVCTNDMFR LALHNFG
Sequence Length
127
Species
Human
Chromosome Location
16q22.1
OMIM Reference Number
605813
cDNA Size
384bp
Vector Description
This shuttle vector contains the complete ORF. It is inseted Nde I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
Vector
(puc19-derived cloning vector)
Preparation Before Usage
1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid.
Preparation and Storage
Store the plasmid at -20 degree C.
Related Product Information for NUTF2 cdna clone
NUTF2 encoded by this gene is a cytosolic factor that facilitates protein transport into the nucleus. It interacts with the nuclear pore complex glycoprotein p62. This encoded protein acts at a relative late stage of nuclear protein import, subsequent to the initial docking of nuclear import ligand at the nuclear envelope. It is thought to be part of a multicomponent system of cytosolic factors that assemble at the pore complex during nuclear import.
Product Categories/Family for NUTF2 cdna clone

NCBI and Uniprot Product Information

NCBI GI #
NCBI Accession #
NCBI GenBank Nucleotide #
UniProt Accession #
NCBI Official Full Name
nuclear transport factor 2
UniProt Protein Name
Nuclear transport factor 2
UniProt Gene Name
NUTF2
UniProt Synonym Gene Names
NTF2; NTF-2; PP15
UniProt Entry Name
NTF2_HUMAN

Uniprot Description

NUTF2: Facilitates protein transport into the nucleus. Interacts with the nucleoporin p62 and with Ran. Acts at a relatively late stage of nuclear protein import, subsequent to the initial docking of nuclear import ligand at the nuclear envelope. Could be part of a multicomponent system of cytosolic factors that assemble at the pore complex during nuclear import. Homodimer.

Protein type: Nuclear import

Chromosomal Location of Human Ortholog: 16q22.1

Cellular Component: nuclear pore; cytosol

Molecular Function: protein binding; transporter activity

Biological Process: protein export from nucleus

Similar Products

Product Notes

The NUTF2 nutf2 (Catalog #AAA200630) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: Nucleotide Sequence: ATGGGAGACA AGCCAATTTG GGAGCAGATT GGATCCAGCT TCATTCAACA TTACTACCAG TTATTTGATA ATGATAGAAC CCAACTAGGC GCAATTTACA TTGACGCGTC ATGCCTTACG TGGGAAGGAC AACAGTTCCA GGGGAAAGCT GCCATTGTGG AGAAGTTGTC TAGCCTTCCG TTCCAGAAAA TTCAGCACAG CATCACCGCG CAGGACCATC AGCCCACTCC AGATAGCTGC ATCATCAGCA TGGTTGTGGG CCAGCTTAAG GCGGATGAAG ACCCCATCAT GGGGTTCCAC CAGATGTTCC TATTAAAGAA CATCAACGAT GCTTGGGTTT GCACCAATGA CATGTTCAGG CTCGCCCTGC ACAACTTTGG CTGA Translat ion Sequence: MGDKPIWEQI GSSFIQHYYQ LFDNDRTQLG AIYIDASCLT WEGQQFQGKA AIVEKLSSLP FQKIQHSITA QDHQPTPDSC IISMVVGQLK ADEDPIMGFH QMFLLKNIND AWVCTNDMFR LALHNFG. It is sometimes possible for the material contained within the vial of "NUTF2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.