Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NUDT16 cdna clone

NUDT16 cDNA Clone

Synonyms
NUDT16; NUDT16 cDNA Clone; NUDT16 cdna clone
Ordering
For Research Use Only!
Sequence
atgctcttcggccgcatcccgctgcgctacgccatactgatgcagatgcgcttcgatggacgcctgggcttccccggcggattcgtggacacgcaggacagaagcctagaggacgggctgaaccgcgagctgcgcgaggagctgggcgaagcggctgccgctttccgcgtggagcgcactgactaccgcagctcccacgtcgggtcagggccacgcgttgtggcccacttctatgccaagcgtctgacgctcgaggagctgttggctgtggaggccggcgcaacacgcgccaaggaccacgggctggaggtgctgggcctggtgcgagtgcccctgtataccctgcgggatggtgtaggaggcctgcctaccttcctggagaattcctttattggctctgcgcgggagcagttacttgaagctctccaggacttgggactgctgcagtctggctctatttcaggccttaagattccagctcatcactag
Sequence Length
489
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
25,259 Da
NCBI Official Full Name
Homo sapiens nudix (nucleoside diphosphate linked moiety X)-type motif 16, mRNA
NCBI Official Synonym Full Names
nudix hydrolase 16
NCBI Official Symbol
NUDT16
NCBI Protein Information
U8 snoRNA-decapping enzyme
UniProt Protein Name
U8 snoRNA-decapping enzyme
Protein Family
UniProt Gene Name
NUDT16
UniProt Synonym Gene Names
IDPase; Nudix motif 16
UniProt Entry Name
NUD16_HUMAN

Uniprot Description

NUDT16: RNA-decapping enzyme that binds specifically to U8 snoRNA. Part of the U8 snoRNP complex that is required for the accumulation of mature 5.8S and 28S rRNA. Has diphosphatase activity and removes m7G and m227G caps from U8 snoRNA. Has broad substrate specificity with manganese or cobalt as cofactor and can act on various RNA species (in vitro). Belongs to the Nudix hydrolase family.

Protein type: Hydrolase; EC 3.6.1.62; Nucleolus

Chromosomal Location of Human Ortholog: 3q22.1

Cellular Component: cytoplasm; nucleolus; nucleoplasm; nucleus

Molecular Function: cobalt ion binding; GTP binding; identical protein binding; m7G(5')pppN diphosphatase activity; magnesium ion binding; manganese ion binding; metalloexopeptidase activity; mRNA binding; protein homodimerization activity; snoRNA binding

Biological Process: adenosine to inosine editing; IDP catabolic process; mRNA catabolic process; positive regulation of cell proliferation; snoRNA catabolic process

Research Articles on NUDT16

Similar Products

Product Notes

The NUDT16 nudt16 (Catalog #AAA1269930) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctcttcg gccgcatccc gctgcgctac gccatactga tgcagatgcg cttcgatgga cgcctgggct tccccggcgg attcgtggac acgcaggaca gaagcctaga ggacgggctg aaccgcgagc tgcgcgagga gctgggcgaa gcggctgccg ctttccgcgt ggagcgcact gactaccgca gctcccacgt cgggtcaggg ccacgcgttg tggcccactt ctatgccaag cgtctgacgc tcgaggagct gttggctgtg gaggccggcg caacacgcgc caaggaccac gggctggagg tgctgggcct ggtgcgagtg cccctgtata ccctgcggga tggtgtagga ggcctgccta ccttcctgga gaattccttt attggctctg cgcgggagca gttacttgaa gctctccagg acttgggact gctgcagtct ggctctattt caggccttaa gattccagct catcactag. It is sometimes possible for the material contained within the vial of "NUDT16, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.