NUDCD2 cdna clone
NUDCD2 cDNA Clone
Gene Names
NUDCD2; NudCL2
Synonyms
NUDCD2; NUDCD2 cDNA Clone; NUDCD2 cdna clone
Sequence
atgtcggccccgtttgaggagcggagtggggtggtaccgtgcgggaccccgtggggccagtggtaccagaccttggaggaggtgttcattgaagttcaggtgccgccaggcacgcgcgcccaggatatccagtgcggcctccagagccggcatgtggcgctgtcggtgggcggccgcgagatcctcaagggcaaactctttgattctacaatagctgatgagggaacatggactttggaggacagaaaaatggttcgtattgttcttacaaagacaaagagagatgcagcaaattgttggacttctctactagaatctgaatatgcagcggatccttgggtgcaagaccaaatgcagagaaagcttacattagagagattccaaaaagaaaatcctggttttgacttcagtggagcagaaatctcaggaaactacactaaaggtggaccagatttctcaaaccttgagaaataa
Sequence Length
474
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
17,676 Da
NCBI Official Full Name
Homo sapiens NudC domain containing 2, mRNA
NCBI Official Synonym Full Names
NudC domain containing 2
NCBI Official Symbol
NUDCD2
NCBI Official Synonym Symbols
NudCL2
NCBI Protein Information
nudC domain-containing protein 2
UniProt Protein Name
NudC domain-containing protein 2
Protein Family
UniProt Gene Name
NUDCD2
UniProt Entry Name
NUDC2_HUMAN
Uniprot Description
NUDCD2: May regulate the LIS1/dynein pathway by stabilizing LIS1 with Hsp90 chaperone.
Protein type: Unknown function
Chromosomal Location of Human Ortholog: 5q34
Cellular Component: cytoplasm; intracellular; microtubule cytoskeleton
Molecular Function: protein binding
Research Articles on NUDCD2
Similar Products
Product Notes
The NUDCD2 nudcd2 (Catalog #AAA1268389) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcggccc cgtttgagga gcggagtggg gtggtaccgt gcgggacccc gtggggccag tggtaccaga ccttggagga ggtgttcatt gaagttcagg tgccgccagg cacgcgcgcc caggatatcc agtgcggcct ccagagccgg catgtggcgc tgtcggtggg cggccgcgag atcctcaagg gcaaactctt tgattctaca atagctgatg agggaacatg gactttggag gacagaaaaa tggttcgtat tgttcttaca aagacaaaga gagatgcagc aaattgttgg acttctctac tagaatctga atatgcagcg gatccttggg tgcaagacca aatgcagaga aagcttacat tagagagatt ccaaaaagaa aatcctggtt ttgacttcag tggagcagaa atctcaggaa actacactaa aggtggacca gatttctcaa accttgagaa ataa. It is sometimes possible for the material contained within the vial of "NUDCD2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
