Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NOLC1 cdna clone

NOLC1 cDNA Clone

Gene Names
NOLC1; P130; NOPP130; NOPP140; NS5ATP13
Synonyms
NOLC1; NOLC1 cDNA Clone; NOLC1 cdna clone
Ordering
For Research Use Only!
Sequence
atgaaaaataaaccaggtccctacagttcagtccccccgccttctgctcccccaccaaagaagtctctgggaacccagcctcccaagaaggctgtggagaagcagcagcctgtggaaagcagtgaagacagcagtgatgagtctgattcaagttctgaagaagagaagaaacccccaactaaggcagtagtctctaaagcaaccactaaaccacctccagcaaagaaagcagcagagagctcttcagacagctcagactctgacagctctgaggatgatgaagctccttctaagccagctggtaccaccaagaattcttcaaataagccagctgtcaccaccaagtcacctgcagtgaagccagctgcagcccccaagcaacctgtgggcggtggccagaagcttctgacgagaaaggctgacagcagctccagtgaggaagagagcagctccagtgaggaggagaagacaaagaagatggtggccaccactaagcccaaggcgactgccaaagcagctctatctctgcctgccaagcaggctcctcagggtagtagggacagcagctctgattcagacagctccagcagtgaggaggaggaagagaagacatctaagtctgcagttaagaagaagccacagaaggtagcaggaggtgcagccccttccaagccagcctctgcaaagaaaggaaaggctgagagcagcaacagttcttcttctgatgactccagtgaggaagaggaagagaagctcaagggcaagggctctccaagaccacaagcccccaaggccaatggcacctctgcactgactgcccagaatggaaaagcagctaagaacagtgaggaggaggaagaagaaaagaaaaaggcggcagtggtagtttccaaatcaggttcattaaagaagcggaagcagaatgaggctgccaaggaggcagagactcctcaggccaagaagataaagcttcagacccctaacacatttccaaaaaggaagaaaggagaaaaaagggcatcatccccattccgaagggtcagggaggaggaaattgaggtggattcacgagttgcggacaactcctttgatgccaagcgaggtgcagccggagactggggagagcgagccaatcaggttttgaagttcaccaaaggcaagtcctttcggcatgagaaaaccaagaagaagcggggcagctaccggggaggctcaatctctgtccaggtcaattctattaagtttgacagcgagtga
Sequence Length
1257
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
73,745 Da
NCBI Official Full Name
Homo sapiens nucleolar and coiled-body phosphoprotein 1, mRNA
NCBI Official Synonym Full Names
nucleolar and coiled-body phosphoprotein 1
NCBI Official Symbol
NOLC1
NCBI Official Synonym Symbols
P130; NOPP130; NOPP140; NS5ATP13
NCBI Protein Information
nucleolar and coiled-body phosphoprotein 1
UniProt Protein Name
Nucleolar and coiled-body phosphoprotein 1
UniProt Gene Name
NOLC1
UniProt Synonym Gene Names
KIAA0035; NS5ATP13; Nopp140; HCV NS5A-transactivated protein 13
UniProt Entry Name
NOLC1_HUMAN

Uniprot Description

NOLC1: Related to nucleologenesis, may play a role in the maintenance of the fundamental structure of the fibrillar center and dense fibrillar component in the nucleolus. It has intrinsic GTPase and ATPase activities. May play an important role in transcription catalyzed by RNA polymerase I. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: RNA-binding; Nucleolus; Transcription, coactivator/corepressor

Chromosomal Location of Human Ortholog: 10q24.32

Cellular Component: nucleolus; nucleoplasm

Molecular Function: protein binding

Biological Process: cell cycle; mitosis; rRNA processing

Research Articles on NOLC1

Similar Products

Product Notes

The NOLC1 nolc1 (Catalog #AAA1273720) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaaaata aaccaggtcc ctacagttca gtccccccgc cttctgctcc cccaccaaag aagtctctgg gaacccagcc tcccaagaag gctgtggaga agcagcagcc tgtggaaagc agtgaagaca gcagtgatga gtctgattca agttctgaag aagagaagaa acccccaact aaggcagtag tctctaaagc aaccactaaa ccacctccag caaagaaagc agcagagagc tcttcagaca gctcagactc tgacagctct gaggatgatg aagctccttc taagccagct ggtaccacca agaattcttc aaataagcca gctgtcacca ccaagtcacc tgcagtgaag ccagctgcag cccccaagca acctgtgggc ggtggccaga agcttctgac gagaaaggct gacagcagct ccagtgagga agagagcagc tccagtgagg aggagaagac aaagaagatg gtggccacca ctaagcccaa ggcgactgcc aaagcagctc tatctctgcc tgccaagcag gctcctcagg gtagtaggga cagcagctct gattcagaca gctccagcag tgaggaggag gaagagaaga catctaagtc tgcagttaag aagaagccac agaaggtagc aggaggtgca gccccttcca agccagcctc tgcaaagaaa ggaaaggctg agagcagcaa cagttcttct tctgatgact ccagtgagga agaggaagag aagctcaagg gcaagggctc tccaagacca caagccccca aggccaatgg cacctctgca ctgactgccc agaatggaaa agcagctaag aacagtgagg aggaggaaga agaaaagaaa aaggcggcag tggtagtttc caaatcaggt tcattaaaga agcggaagca gaatgaggct gccaaggagg cagagactcc tcaggccaag aagataaagc ttcagacccc taacacattt ccaaaaagga agaaaggaga aaaaagggca tcatccccat tccgaagggt cagggaggag gaaattgagg tggattcacg agttgcggac aactcctttg atgccaagcg aggtgcagcc ggagactggg gagagcgagc caatcaggtt ttgaagttca ccaaaggcaa gtcctttcgg catgagaaaa ccaagaagaa gcggggcagc taccggggag gctcaatctc tgtccaggtc aattctatta agtttgacag cgagtga. It is sometimes possible for the material contained within the vial of "NOLC1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.