Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NCOA5 cdna clone

NCOA5 cDNA Clone

Gene Names
NCOA5; CIA; bA465L10.6
Synonyms
NCOA5; NCOA5 cDNA Clone; NCOA5 cdna clone
Ordering
For Research Use Only!
Sequence
atggccgggatgcccgggacagcagagacattcgagacccccgagacttgcgggaccacagacatgagagactcccgagatcctatgtacaggagagaaggctcttatgaccgatacctacgaatggatgactattgcaggagaaaggatgactcttattttgaccgttacagagatagctttgatggacggggccctccaggcccagaaagtcagtctcgtgcaaaagagcgtttgaaacgtgaggaacggcgtagagaagagctttatcgtcaatattttgaggaaatccagagacgctttgatgccgaaaggcccgttgattgttctgtgattgtggtcaacaaacagacaaaagactatgctgagtctgtggggcggaaggtgcgagacctgggcatggtagtggacttgatcttccttaacacagaagtgtcactgtcacaagccttggaggatgttagcaggggaggttctccttttgctattgtcatcacccagcaacaccagattcaccgctcctgcacagtcaacatcatgtttggaaccccgcaagagcatcgcaacatgccccaagcagatgccatggtgctggtggccagaaattatgagcgttacaagaatgagtgccgggagaaggaacgtgaggagattgccagacaggcagccaagatggccgatgaagccatcctgcaggaaagagagagaggaggccctgaggagggagtgcgtgggggccaccctccagccatccagagcctcatcaacctgctggcagacaacaggtacctcactgctgaagagactgacaagatcatcaactacctgcgagagcggaaggagcggctgatgaggagcagcaccgactctctgcctggtgagctacgtggcagggccgaggcccgatttcccgccaaccactcggggcgacctcgggtgcctcgctga
Sequence Length
948
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
65,536 Da
NCBI Official Full Name
Homo sapiens cDNA clone IMAGE:5730450, containing frame-shift errors
NCBI Official Synonym Full Names
nuclear receptor coactivator 5
NCBI Official Symbol
NCOA5
NCBI Official Synonym Symbols
CIA; bA465L10.6
NCBI Protein Information
nuclear receptor coactivator 5
UniProt Protein Name
Nuclear receptor coactivator 5
UniProt Gene Name
NCOA5
UniProt Synonym Gene Names
KIAA1637; NCoA-5; CIA
UniProt Entry Name
NCOA5_HUMAN

NCBI Description

This gene encodes a coregulator for the alpha and beta estrogen receptors and the orphan nuclear receptor NR1D2. The protein localizes to the nucleus, and is thought to have both coactivator and corepressor functions. Its interaction with nuclear receptors is independent of the AF2 domain on the receptors, which is known to regulate interaction with other coreceptors. Two alternatively spliced transcript variants for this gene have been described. However, the full length nature of one of the variants has not been determined. [provided by RefSeq, Jul 2008]

Uniprot Description

NCOA5: Nuclear receptor coregulator that can have both coactivator and corepressor functions. Interacts with nuclear receptors for steroids (ESR1 and ESR2) independently of the steroid binding domain (AF-2) of the ESR receptors, and with the orphan nuclear receptor NR1D2. Involved in the coactivation of nuclear steroid receptors (ER) as well as the corepression of MYC in response to 17-beta-estradiol (E2).

Protein type: Nuclear receptor co-regulator; Transcription, coactivator/corepressor

Chromosomal Location of Human Ortholog: 20q13.12

Cellular Component: actin cytoskeleton; extracellular space; nucleus

Molecular Function: protein binding

Research Articles on NCOA5

Similar Products

Product Notes

The NCOA5 ncoa5 (Catalog #AAA1271158) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccggga tgcccgggac agcagagaca ttcgagaccc ccgagacttg cgggaccaca gacatgagag actcccgaga tcctatgtac aggagagaag gctcttatga ccgataccta cgaatggatg actattgcag gagaaaggat gactcttatt ttgaccgtta cagagatagc tttgatggac ggggccctcc aggcccagaa agtcagtctc gtgcaaaaga gcgtttgaaa cgtgaggaac ggcgtagaga agagctttat cgtcaatatt ttgaggaaat ccagagacgc tttgatgccg aaaggcccgt tgattgttct gtgattgtgg tcaacaaaca gacaaaagac tatgctgagt ctgtggggcg gaaggtgcga gacctgggca tggtagtgga cttgatcttc cttaacacag aagtgtcact gtcacaagcc ttggaggatg ttagcagggg aggttctcct tttgctattg tcatcaccca gcaacaccag attcaccgct cctgcacagt caacatcatg tttggaaccc cgcaagagca tcgcaacatg ccccaagcag atgccatggt gctggtggcc agaaattatg agcgttacaa gaatgagtgc cgggagaagg aacgtgagga gattgccaga caggcagcca agatggccga tgaagccatc ctgcaggaaa gagagagagg aggccctgag gagggagtgc gtgggggcca ccctccagcc atccagagcc tcatcaacct gctggcagac aacaggtacc tcactgctga agagactgac aagatcatca actacctgcg agagcggaag gagcggctga tgaggagcag caccgactct ctgcctggtg agctacgtgg cagggccgag gcccgatttc ccgccaacca ctcggggcga cctcgggtgc ctcgctga. It is sometimes possible for the material contained within the vial of "NCOA5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.