NCDN cdna clone
NCDN cDNA Clone
Synonyms
NCDN; NCDN cDNA Clone; NCDN cdna clone
Sequence
atgtcgtgttgtgacctggctgcggcgggacagttgggcaaggcgagcatcatggcctcggattgcgagccagctctgaaccaggcagagggccgaaaccccaccctggagcgctacctgggagccctccgtgaggccaagaatgacagcgagcagtttgcagccctgctgctagtgaccaaggcagtcaaagcaggtgacatagatgccaaaactcggcggcggatcttcgatgctgtcggcttcaccttccccaatcgtctcctgaccaccaaggaggcgccggatggctgccctgaccatgttctgcgggctttgggtgtggccctgctggcctgcttctgcagtgaccctgaactggccgcccatccccaagtcctgaacaagattcccattcttagcaccttcctcacagcccggggggacccggacgatgctgcccgccgctccatgattgatgacacctaccagtgcctgacggctgtagcaggcacacccagagggcctcggcacctcattgctggtggcaccgtgtctgccctatgccaggcatacctggggcacggctatggctttgaccaggccctggcactcctggtggggctgctggctgctgccgagacacagtgctggaaggaggcggagcccgacctgctggccgtgttgcggggcctcagtgaggatttccagaaagctgaggatgccagcaagtttgagctctgccagctgctgcccctctttttgcccccgacaaccgtgccccctgaatgctaccgggatctgcaggccgggctggcacgcatcctgggaagcaagctgagctcctggcagcgcaaccctgcactgaagctggcagcccgcctggcacacgcctgcggctccgactggatcccggcgggcagctccgggagcaagttcctggccctgctggtgaatctggcgtgcgtggaagtgcggctggcactggaggagacgggcacggaggtgaaagaggatgtggtgaccgcctgctatgccctcatggagttggggatccaggaatgcactcgctgtgagcagtcactgcttaaggagccacagaaggtgcagctcgtgagcgtcatgaaggaggccataggggctgttatccactacctgctgcaggtggggtcagagaagcagaaggagccctttgtgtttgcctcggtgcggatcctgggtgcctggctggccgaggagacctcatccttgcgtaaggaggtgtgccagctgctgcccttcctcgtccgctatgccaagaccctctacgaggaggccgaggaggccaatgacctttcccagcaggtggccaacctggccatctcccccaccaccccagggcccacctggccaggagacgctctccggctcctcctgcctggctggtgccacctgaccgttgaagatgggccccgggagatcctgatcaaggaaggggccccctcgcttctgtgcaagtatttcctgcagcagtgggaactcacatcccctggccacgacacctcggtgctgcctgacagcgtggagattggcctgcagacctgctgccacatcttcctcaacctcgtggtcaccgcaccggggctgatcaagcgtgacgcctgcttcacatctctaatgaacaccctcatgacgtcgctaccagcactagtgcagcaacagggaaggctgcttctggctgctaatgtggccaccctggggctcctcatggcccggctccttagcacctctccagctcttcagggaacaccagcatcccgagggttcttcgcagctgccatcctcttcctatcacagtcccacgtggcgcgggccaccccgggctcagaccaggcagtgctagccctgtcccctgagtatgagggcatctgggccgacctgcaggagctctggttcctgggcatgcaggccttcaccggctgtgtgcctctgctgccctggctggcccccgctgccctgcgctcccgctggccgcaggagctgctccagctgctaggcagtgtcagccccaactctgtcaagcccgagatggtggccgcctatcagggtgtcctggtggagctggcgcgggccaaccggctgtgccgggaggccatgaggctgcaggcgggcgaggagacggccagccactaccgcatggctgccttggagcagtgcctgtcagagccctga
Sequence Length
2190
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
79,158 Da
NCBI Official Full Name
Homo sapiens neurochondrin, mRNA
NCBI Official Synonym Full Names
neurochondrin
NCBI Official Symbol
NCDN
NCBI Protein Information
neurochondrin
UniProt Protein Name
Neurochondrin
Protein Family
UniProt Gene Name
NCDN
UniProt Synonym Gene Names
KIAA0607
UniProt Entry Name
NCDN_HUMAN
NCBI Description
This gene encodes a leucine-rich cytoplasmic protein, which is highly similar to a mouse protein that negatively regulates Ca/calmodulin-dependent protein kinase II phosphorylation and may be essential for spatial learning processes. Several alternatively spliced transcript variants of this gene have been described. [provided by RefSeq, Jul 2008]
Uniprot Description
NCDN: Probably involved in signal transduction, in the nervous system, via increasing cell surface localization of GRM5 and positively regulating its signaling. Required for the spatial learning process. Acts as a negative regulator of Ca(2+)-calmodulin-dependent protein kinase 2 (CaMK2) phosphorylation. May play a role in modulating melanin- concentrating hormone-mediated functions via its interaction with MCHR1 that interferes with G protein-coupled signal transduction. May be involved in bone metabolism. May also be involved in neurite outgrowth. Belongs to the neurochondrin family. 3 isoforms of the human protein are produced by alternative splicing.
Protein type: Inhibitor
Chromosomal Location of Human Ortholog: 1p34.3
Cellular Component: axon; cell soma; cytosol; dendrite; membrane; nucleus
Molecular Function: protein binding
Biological Process: neurite development
Research Articles on NCDN
Similar Products
Product Notes
The NCDN ncdn (Catalog #AAA1269047) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcgtgtt gtgacctggc tgcggcggga cagttgggca aggcgagcat catggcctcg gattgcgagc cagctctgaa ccaggcagag ggccgaaacc ccaccctgga gcgctacctg ggagccctcc gtgaggccaa gaatgacagc gagcagtttg cagccctgct gctagtgacc aaggcagtca aagcaggtga catagatgcc aaaactcggc ggcggatctt cgatgctgtc ggcttcacct tccccaatcg tctcctgacc accaaggagg cgccggatgg ctgccctgac catgttctgc gggctttggg tgtggccctg ctggcctgct tctgcagtga ccctgaactg gccgcccatc cccaagtcct gaacaagatt cccattctta gcaccttcct cacagcccgg ggggacccgg acgatgctgc ccgccgctcc atgattgatg acacctacca gtgcctgacg gctgtagcag gcacacccag agggcctcgg cacctcattg ctggtggcac cgtgtctgcc ctatgccagg catacctggg gcacggctat ggctttgacc aggccctggc actcctggtg gggctgctgg ctgctgccga gacacagtgc tggaaggagg cggagcccga cctgctggcc gtgttgcggg gcctcagtga ggatttccag aaagctgagg atgccagcaa gtttgagctc tgccagctgc tgcccctctt tttgcccccg acaaccgtgc cccctgaatg ctaccgggat ctgcaggccg ggctggcacg catcctggga agcaagctga gctcctggca gcgcaaccct gcactgaagc tggcagcccg cctggcacac gcctgcggct ccgactggat cccggcgggc agctccggga gcaagttcct ggccctgctg gtgaatctgg cgtgcgtgga agtgcggctg gcactggagg agacgggcac ggaggtgaaa gaggatgtgg tgaccgcctg ctatgccctc atggagttgg ggatccagga atgcactcgc tgtgagcagt cactgcttaa ggagccacag aaggtgcagc tcgtgagcgt catgaaggag gccatagggg ctgttatcca ctacctgctg caggtggggt cagagaagca gaaggagccc tttgtgtttg cctcggtgcg gatcctgggt gcctggctgg ccgaggagac ctcatccttg cgtaaggagg tgtgccagct gctgcccttc ctcgtccgct atgccaagac cctctacgag gaggccgagg aggccaatga cctttcccag caggtggcca acctggccat ctcccccacc accccagggc ccacctggcc aggagacgct ctccggctcc tcctgcctgg ctggtgccac ctgaccgttg aagatgggcc ccgggagatc ctgatcaagg aaggggcccc ctcgcttctg tgcaagtatt tcctgcagca gtgggaactc acatcccctg gccacgacac ctcggtgctg cctgacagcg tggagattgg cctgcagacc tgctgccaca tcttcctcaa cctcgtggtc accgcaccgg ggctgatcaa gcgtgacgcc tgcttcacat ctctaatgaa caccctcatg acgtcgctac cagcactagt gcagcaacag ggaaggctgc ttctggctgc taatgtggcc accctggggc tcctcatggc ccggctcctt agcacctctc cagctcttca gggaacacca gcatcccgag ggttcttcgc agctgccatc ctcttcctat cacagtccca cgtggcgcgg gccaccccgg gctcagacca ggcagtgcta gccctgtccc ctgagtatga gggcatctgg gccgacctgc aggagctctg gttcctgggc atgcaggcct tcaccggctg tgtgcctctg ctgccctggc tggcccccgc tgccctgcgc tcccgctggc cgcaggagct gctccagctg ctaggcagtg tcagccccaa ctctgtcaag cccgagatgg tggccgccta tcagggtgtc ctggtggagc tggcgcgggc caaccggctg tgccgggagg ccatgaggct gcaggcgggc gaggagacgg ccagccacta ccgcatggct gccttggagc agtgcctgtc agagccctga. It is sometimes possible for the material contained within the vial of "NCDN, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
