NAPB cdna clone
NAPB cDNA Clone
Gene Names
NAPB; SNAPB; SNAP-BETA
Synonyms
NAPB; NAPB cDNA Clone; NAPB cdna clone
Sequence
atggacaacgcggggaaggagcgtgaggcagtacagctgatggcggaggccgagaagcgagtcaaggcctcccactccttcctccgagggctgtttggaggaaacacaagaatagaagaggcttgtgaaatgtataccagagctgcaaatatgttcaagatggctaaaaattggagtgctgcaggaaacgcattttgtcaggcagccaagctccacatgcagcttcagagcaaacatgactctgctaccagctttgtggatgctggaaatgcttacaaaaaggcagatccccaagaggctatcaactgcttaaatgcagccatcgacatttacacagacatgggaaggtttacaattgcagccaagcaccacattactattgcagagatctatgagactgaacttgtagacattgagaaggctattgcacattatgaacaatctgctgattattacaaaggagaagaatccaacagctcagcaaacaagtgtctgctgaaggtggcagcatatgctgcccagcttgagcagtaccagaaagccattgagatctatgagcaggttggggcaaacacaatggataatcctttgttgaaatacagtgcaaaggattacttcttcaaagctgccctctgccacttcatagtagacgagttgaatgccaagcttgctcttgagaaatatgaggaaatgtttccagcatttactgattcaagagaatgtaaattattgaaaaaactcctagaagctcatgaagaacagaacagtgaagcttacactgaagcagtgaaggaatttgactcaatatctcgcttggatcagtggctgaccaccatgttgcttcgcatcaaaaagtccatccaaggggatggagaaggagatggagacctaaaatga
Sequence Length
897
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
23,403 Da
NCBI Official Full Name
Homo sapiens N-ethylmaleimide-sensitive factor attachment protein, beta, mRNA
NCBI Official Synonym Full Names
NSF attachment protein beta
NCBI Official Symbol
NAPB
NCBI Official Synonym Symbols
SNAPB; SNAP-BETA
NCBI Protein Information
beta-soluble NSF attachment protein
UniProt Protein Name
Beta-soluble NSF attachment protein
Protein Family
UniProt Gene Name
NAPB
UniProt Synonym Gene Names
SNAPB; SNAP-beta
UniProt Entry Name
SNAB_HUMAN
Uniprot Description
NAPB: Required for vesicular transport between the endoplasmic reticulum and the Golgi apparatus. Belongs to the SNAP family.
Protein type: Endoplasmic reticulum
Chromosomal Location of Human Ortholog: 20p12.3-p11.21
Cellular Component: SNARE complex; vacuolar membrane
Molecular Function: protein binding; soluble NSF attachment protein activity; syntaxin binding
Biological Process: intracellular protein transport
Similar Products
Product Notes
The NAPB napb (Catalog #AAA1269410) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacaacg cggggaagga gcgtgaggca gtacagctga tggcggaggc cgagaagcga gtcaaggcct cccactcctt cctccgaggg ctgtttggag gaaacacaag aatagaagag gcttgtgaaa tgtataccag agctgcaaat atgttcaaga tggctaaaaa ttggagtgct gcaggaaacg cattttgtca ggcagccaag ctccacatgc agcttcagag caaacatgac tctgctacca gctttgtgga tgctggaaat gcttacaaaa aggcagatcc ccaagaggct atcaactgct taaatgcagc catcgacatt tacacagaca tgggaaggtt tacaattgca gccaagcacc acattactat tgcagagatc tatgagactg aacttgtaga cattgagaag gctattgcac attatgaaca atctgctgat tattacaaag gagaagaatc caacagctca gcaaacaagt gtctgctgaa ggtggcagca tatgctgccc agcttgagca gtaccagaaa gccattgaga tctatgagca ggttggggca aacacaatgg ataatccttt gttgaaatac agtgcaaagg attacttctt caaagctgcc ctctgccact tcatagtaga cgagttgaat gccaagcttg ctcttgagaa atatgaggaa atgtttccag catttactga ttcaagagaa tgtaaattat tgaaaaaact cctagaagct catgaagaac agaacagtga agcttacact gaagcagtga aggaatttga ctcaatatct cgcttggatc agtggctgac caccatgttg cttcgcatca aaaagtccat ccaaggggat ggagaaggag atggagacct aaaatga. It is sometimes possible for the material contained within the vial of "NAPB, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
