N6AMT2 cdna clone
N6AMT2 cDNA Clone
Gene Names
EEF1AKMT1; ESP13; N6AMT2
Synonyms
N6AMT2; N6AMT2 cDNA Clone; N6AMT2 cdna clone
Sequence
atgagtgatttggaagatgatgagacaccccagctttctgcccatgccttagcagctctccaggaattttatgctgagcaaaagcaacaaattgagccaggcgaggatgataaatataacattggaataatagaagagaattggcaactgagccagttttggtatagtcaggaaactgctctgcagctggcacaggaggcaattgcagctgtaggagaaggtggcagaatcgcatgtgtgagtgcccctagtgtttaccagaaactcagagagctgtgcagagaaaacttttcgatatacatctttgaatatgacaaaagatttgccatgtatggagaggagtttattttctatgattacaataatccattggacttacccgaaagaattgctgcacatagttttgacatcgtaatagcagatcctccctatctttcggaggaatgtctcagaaaaacatcggaaaccgtcaagtacctgacgcggggcaagattctgctgtgcacaggtgccatcatggaagaacaggcagcagaactccttggagtgaagatgtgcacgtttgttccaagacacacccggaacttggcaaatgagtttcgctgttatgtgaattatgattctgggctggactgtgggatctga
Sequence Length
645
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
24,506 Da
NCBI Official Full Name
Homo sapiens N-6 adenine-specific DNA methyltransferase 2 (putative), mRNA
NCBI Official Synonym Full Names
eukaryotic translation elongation factor 1 alpha lysine methyltransferase 1
NCBI Official Symbol
EEF1AKMT1
NCBI Official Synonym Symbols
ESP13; N6AMT2
NCBI Protein Information
protein-lysine N-methyltransferase N6AMT2
UniProt Protein Name
Protein-lysine N-methyltransferase N6AMT2
Protein Family
UniProt Gene Name
N6AMT2
UniProt Entry Name
N6MT2_HUMAN
Uniprot Description
N6AMT2: Putative DNA methyltransferase. Belongs to the methyltransferase superfamily. AML1 family.
Protein type: Methyltransferase; EC 2.1.1.-
Chromosomal Location of Human Ortholog: 13q12.11
Similar Products
Product Notes
The N6AMT2 n6amt2 (Catalog #AAA1277781) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagtgatt tggaagatga tgagacaccc cagctttctg cccatgcctt agcagctctc caggaatttt atgctgagca aaagcaacaa attgagccag gcgaggatga taaatataac attggaataa tagaagagaa ttggcaactg agccagtttt ggtatagtca ggaaactgct ctgcagctgg cacaggaggc aattgcagct gtaggagaag gtggcagaat cgcatgtgtg agtgccccta gtgtttacca gaaactcaga gagctgtgca gagaaaactt ttcgatatac atctttgaat atgacaaaag atttgccatg tatggagagg agtttatttt ctatgattac aataatccat tggacttacc cgaaagaatt gctgcacata gttttgacat cgtaatagca gatcctccct atctttcgga ggaatgtctc agaaaaacat cggaaaccgt caagtacctg acgcggggca agattctgct gtgcacaggt gccatcatgg aagaacaggc agcagaactc cttggagtga agatgtgcac gtttgttcca agacacaccc ggaacttggc aaatgagttt cgctgttatg tgaattatga ttctgggctg gactgtggga tctga. It is sometimes possible for the material contained within the vial of "N6AMT2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
