Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

Vector Map

MYD88 cdna clone

MYD88 cDNA Clone

Gene Names
MYD88; MYD88D
Synonyms
MYD88; MYD88 cDNA Clone; MYD88 cdna clone
Ordering
For Research Use Only!
Sequence
atggctgcaggaggtcccggcgcggggtctgcggccccggtctcctccacatcctcccttcccctggctgctctcaacatgcgagtgcggcgccgcctgtctctgttcttgaacgtgcggacacaggtggcggccgactggaccgcgctggcggaggagatggactttgagtacttggagatccggcaactggagacacaagcggaccccactggcaggctgctggacgcctggcagggacgccctggcgcctctgtaggccgactgctcgagctgcttaccaagctgggccgcgacgacgtgctgctggagctgggacccagcattgaggaggattgccaaaagtatatcttgaagcagcagcaggaggaggctgagaagcctttacaggtggccgctgtagacagcagtgtcccacggacagcagagctggcgggcatcaccacacttgatgaccccctggggcatatgcctgagcgtttcgatgccttcatctgctattgccccagcgacatccagtttgtgcaggagatgatccggcaactggaacagacaaactatcgactgaagttgtgtgtgtctgaccgcgatgtcctgcctggcacctgtgtctggtctattgctagtgagctcatcgaaaagaggtgccgccggatggtggtggttgtctctgatgattacctgcagagcaaggaatgtgacttccagaccaaatttgcactcagcctctctccaggtgcccatcagaagcgactgatccccatcaagtacaaggcaatgaagaaagagttccccagcatcctgaggttcatcactgtctgcgactacaccaacccctgcaccaaatcttggttctggactcgccttgccaaggccttgtccctgccctga
Sequence Length
891
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

Vector Map

Vector Map

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
34,097 Da
NCBI Official Full Name
Homo sapiens myeloid differentiation primary response gene (88), mRNA
NCBI Official Synonym Full Names
myeloid differentiation primary response 88
NCBI Official Symbol
MYD88
NCBI Official Synonym Symbols
MYD88D
NCBI Protein Information
myeloid differentiation primary response protein MyD88
UniProt Protein Name
Myeloid differentiation primary response protein MyD88
UniProt Gene Name
MYD88
UniProt Entry Name
MYD88_HUMAN

NCBI Description

This gene encodes a cytosolic adapter protein that plays a central role in the innate and adaptive immune response. This protein functions as an essential signal transducer in the interleukin-1 and Toll-like receptor signaling pathways. These pathways regulate that activation of numerous proinflammatory genes. The encoded protein consists of an N-terminal death domain and a C-terminal Toll-interleukin1 receptor domain. Patients with defects in this gene have an increased susceptibility to pyogenic bacterial infections. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]

Uniprot Description

MYD88: Adapter protein involved in the Toll-like receptor and IL-1 receptor signaling pathway in the innate immune response. Acts via IRAK1, IRAK2, IRF7 and TRAF6, leading to NF-kappa-B activation, cytokine secretion and the inflammatory response. Increases IL-8 transcription. Involved in IL-18-mediated signaling pathway. Activates IRF1 resulting in its rapid migration into the nucleus to mediate an efficient induction of IFN-beta, NOS2/INOS, and IL12A genes. Homodimer. Also forms heterodimers with TIRAP. Binds to TLR2, TLR4, IRAK1, IRAK2 and IRAK4 via their respective TIR domains. Interacts with IL18R1. Interacts with BMX, IL1RL1 and IRF7. Interacts with LRRFIP1 and LRRFIP2; this interaction positively regulates Toll-like receptor (TLR) signaling in response to agonist. Interacts with FLII. LRRFIP1 and LRRFIP2 compete with FLII for MYD88-binding. Interacts with IRF1. Ubiquitous. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Adaptor/scaffold

Chromosomal Location of Human Ortholog: 3p22

Cellular Component: cytoplasm; cytosol; endosome membrane; nucleus; plasma membrane

Molecular Function: death receptor binding; identical protein binding; protein binding; protein self-association

Biological Process: activation of NF-kappaB transcription factor; apoptosis; cell surface receptor linked signal transduction; defense response to Gram-positive bacterium; MyD88-dependent toll-like receptor signaling pathway; negative regulation of apoptosis; positive regulation of I-kappaB kinase/NF-kappaB cascade; positive regulation of interferon type I production; positive regulation of interleukin-17 production; positive regulation of interleukin-23 production; positive regulation of interleukin-6 production; regulation of inflammatory response; toll-like receptor 9 signaling pathway; toll-like receptor signaling pathway

Disease: Macroglobulinemia, Waldenstrom, Susceptibility To, 1; Myd88 Deficiency

Research Articles on MYD88

Similar Products

Product Notes

The MYD88 myd88 (Catalog #AAA1277846) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctgcag gaggtcccgg cgcggggtct gcggccccgg tctcctccac atcctccctt cccctggctg ctctcaacat gcgagtgcgg cgccgcctgt ctctgttctt gaacgtgcgg acacaggtgg cggccgactg gaccgcgctg gcggaggaga tggactttga gtacttggag atccggcaac tggagacaca agcggacccc actggcaggc tgctggacgc ctggcaggga cgccctggcg cctctgtagg ccgactgctc gagctgctta ccaagctggg ccgcgacgac gtgctgctgg agctgggacc cagcattgag gaggattgcc aaaagtatat cttgaagcag cagcaggagg aggctgagaa gcctttacag gtggccgctg tagacagcag tgtcccacgg acagcagagc tggcgggcat caccacactt gatgaccccc tggggcatat gcctgagcgt ttcgatgcct tcatctgcta ttgccccagc gacatccagt ttgtgcagga gatgatccgg caactggaac agacaaacta tcgactgaag ttgtgtgtgt ctgaccgcga tgtcctgcct ggcacctgtg tctggtctat tgctagtgag ctcatcgaaa agaggtgccg ccggatggtg gtggttgtct ctgatgatta cctgcagagc aaggaatgtg acttccagac caaatttgca ctcagcctct ctccaggtgc ccatcagaag cgactgatcc ccatcaagta caaggcaatg aagaaagagt tccccagcat cctgaggttc atcactgtct gcgactacac caacccctgc accaaatctt ggttctggac tcgccttgcc aaggccttgt ccctgccctg a. It is sometimes possible for the material contained within the vial of "MYD88, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.