Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MTDH cdna clone

MTDH cDNA Clone

Gene Names
MTDH; 3D3; AEG1; AEG-1; LYRIC; LYRIC/3D3
Synonyms
MTDH; MTDH cDNA Clone; MTDH cdna clone
Ordering
For Research Use Only!
Sequence
atggctgcacggagctggcaggacgagctggcccagcaggccgaggagggctcggcccggctgcgggaaatgctctcggtcggcctaggctttctgcgcaccgagctgggcctcgacctggggctggagccgaaacggtaccccggctgggtgatcctggtgggcactggcgcgctcgggctgctgctgctgtttctgctgggctacggctgggccgcggcttgcgccggctcccgcaaaaagcggaggagcccgccccgcaagcgggaggaggcggcggccgtgccggccgcggcccccgacgacctggccttgctgaagaatctccggagcgaggaacagaagaagaagaaccggaagaaactgtccgagaagcccaaaccaaatgggcggactgttgaagtggctgagggtgaagctgttcgaacacctcaaagtgtaacagcaaagcagccaccagagattgacaagaaaaatgaaaagtcaaagaaaaataagaagaaatcaaagtcagatgctaaagcagtgcaaaacagttcacgccatgatggaaaggaagttgatgaaggagcctgggaaactaaaattagtcacagagagaaacgacagcagcgtaaacgtgataaggtgctgactgattctggttcattggattcaactatccctgggatagaaaataccatcacagttaccaccgagcaacttacaaccgcatcatttcctgttggttccaagaagaataaaggtgattctcatctaaatgttcaagttagcaactttaaatctggaaaaggagattctacacttcaggtttcttcaggattgaatgaaaacctcactgtcaatggaggaggctggaatgaaaagtctgtaaaactctcctcacagatcagtgcaggtgaggagaagtggaactccgtttcacctgcttctgcaggaaagaggaaagctgagccatctgcctggagtcaagacactggagatgctaatacaaatggaaaagactggggaaggagttggagtgaccgttcaatattttctggcattgggtctactgctgagccagtttctcagtctaccacttctgattatcagtgggatgttagccgtaatcaaccctatatcgatgatgaatggtctgggttaaatggtctgtcttctgctgatcccaactctgattggaatgcaccagcagaagagtggggcaattgggtagacgaagaaagagcttcacttctaaagtcccaggaaccaattcctgatgatcaaaaggtctcagatgatgataaagaaaagggagagggagctcttccaactgggaaatccaaaaagaaaaaaaagaaaaagaagaagcaaggtgaagataactctactgcacaggacacagaagaattagaaaaagagattagagaagaccttccagtgaatacctctaaaacccgtccaaaacaggaaaaagctttttccttgaagaccataagcactagtgatccagccgaagtactcgtcaaaaatagccagcctatcaagactcttccacctgctacttctaccgagccatctgtaatcttatcaaaaagtgattctgacaagagctcttcccaagtgccgccaatactacaagagacagataaatccaagtcaaataccaagcaaaatagtgtgcctccttcacagaccaagtctgaaactagctgggaatctcccaaacaaataaaaaagaagaaaaaagccagacgagaaacgtga
Sequence Length
1749
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
63,837 Da
NCBI Official Full Name
Homo sapiens metadherin, mRNA
NCBI Official Synonym Full Names
metadherin
NCBI Official Symbol
MTDH
NCBI Official Synonym Symbols
3D3; AEG1; AEG-1; LYRIC; LYRIC/3D3
NCBI Protein Information
protein LYRIC
UniProt Protein Name
Protein LYRIC
Protein Family
UniProt Gene Name
MTDH
UniProt Synonym Gene Names
AEG1; LYRIC; AEG-1
UniProt Entry Name
LYRIC_HUMAN

Uniprot Description

Lyric: a protein of unknown function.

Protein type: Cell adhesion; Nucleolus; Membrane protein, integral

Chromosomal Location of Human Ortholog: 8q22.1

Cellular Component: apical plasma membrane; cytoplasm; endoplasmic reticulum; endoplasmic reticulum membrane; intercellular canaliculus; nuclear body; nucleolus; nucleus; perinuclear region of cytoplasm; tight junction

Molecular Function: double-stranded RNA binding; NF-kappaB binding; protein binding; transcription coactivator activity

Biological Process: activation of NF-kappaB transcription factor; lipopolysaccharide-mediated signaling pathway; negative regulation of apoptosis; negative regulation of transcription from RNA polymerase II promoter; positive regulation of angiogenesis; positive regulation of autophagy; positive regulation of I-kappaB kinase/NF-kappaB cascade; positive regulation of protein kinase B signaling cascade

Research Articles on MTDH

Similar Products

Product Notes

The MTDH mtdh (Catalog #AAA1266239) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctgcac ggagctggca ggacgagctg gcccagcagg ccgaggaggg ctcggcccgg ctgcgggaaa tgctctcggt cggcctaggc tttctgcgca ccgagctggg cctcgacctg gggctggagc cgaaacggta ccccggctgg gtgatcctgg tgggcactgg cgcgctcggg ctgctgctgc tgtttctgct gggctacggc tgggccgcgg cttgcgccgg ctcccgcaaa aagcggagga gcccgccccg caagcgggag gaggcggcgg ccgtgccggc cgcggccccc gacgacctgg ccttgctgaa gaatctccgg agcgaggaac agaagaagaa gaaccggaag aaactgtccg agaagcccaa accaaatggg cggactgttg aagtggctga gggtgaagct gttcgaacac ctcaaagtgt aacagcaaag cagccaccag agattgacaa gaaaaatgaa aagtcaaaga aaaataagaa gaaatcaaag tcagatgcta aagcagtgca aaacagttca cgccatgatg gaaaggaagt tgatgaagga gcctgggaaa ctaaaattag tcacagagag aaacgacagc agcgtaaacg tgataaggtg ctgactgatt ctggttcatt ggattcaact atccctggga tagaaaatac catcacagtt accaccgagc aacttacaac cgcatcattt cctgttggtt ccaagaagaa taaaggtgat tctcatctaa atgttcaagt tagcaacttt aaatctggaa aaggagattc tacacttcag gtttcttcag gattgaatga aaacctcact gtcaatggag gaggctggaa tgaaaagtct gtaaaactct cctcacagat cagtgcaggt gaggagaagt ggaactccgt ttcacctgct tctgcaggaa agaggaaagc tgagccatct gcctggagtc aagacactgg agatgctaat acaaatggaa aagactgggg aaggagttgg agtgaccgtt caatattttc tggcattggg tctactgctg agccagtttc tcagtctacc acttctgatt atcagtggga tgttagccgt aatcaaccct atatcgatga tgaatggtct gggttaaatg gtctgtcttc tgctgatccc aactctgatt ggaatgcacc agcagaagag tggggcaatt gggtagacga agaaagagct tcacttctaa agtcccagga accaattcct gatgatcaaa aggtctcaga tgatgataaa gaaaagggag agggagctct tccaactggg aaatccaaaa agaaaaaaaa gaaaaagaag aagcaaggtg aagataactc tactgcacag gacacagaag aattagaaaa agagattaga gaagaccttc cagtgaatac ctctaaaacc cgtccaaaac aggaaaaagc tttttccttg aagaccataa gcactagtga tccagccgaa gtactcgtca aaaatagcca gcctatcaag actcttccac ctgctacttc taccgagcca tctgtaatct tatcaaaaag tgattctgac aagagctctt cccaagtgcc gccaatacta caagagacag ataaatccaa gtcaaatacc aagcaaaata gtgtgcctcc ttcacagacc aagtctgaaa ctagctggga atctcccaaa caaataaaaa agaagaaaaa agccagacga gaaacgtga. It is sometimes possible for the material contained within the vial of "MTDH, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.