Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MT2A cdna clone

MT2A

Gene Names
MT2A; MT2; MT-2; MT-II
Synonyms
MT2A; MT2; MT2A cdna clone
Ordering
For Research Use Only!
Form/Format
Lyophilized
Sequence
Nucleotide Sequence: ATGGATCCCAACTGCTCCTGCGCCGCCGGTGACTCCTGCACCTGCGCCGGCTCCTGCAAATGCAAAGAGTGCAAATGCACCTCCTGCAAGAAAAGCTGCTGCTCCTGCTGCCCTGTGGGCTGTGCCAAGTGTGCCCAGGGCTGCATCTGCAAAGGGGCGTCGGACAAGTGCAGCTGCTGCGCCTGA

Translation Sequence: MDPNCSCAAG DSCTCAGSCK CKECKCTSCK KSCCSCCPVG CAKCAQGCIC KGASDKCSCCA
Sequence Length
61
Species
Human
Chromosome Location
16q13
OMIM Reference Number
156360
cDNA Size
186bp
Vector Description
This shuttle vector contains the complete ORF. It is inseted Nde I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
Vector
(puc19-derived cloning vector)
Preparation Before Usage
1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid.
Preparation and Storage
Store the plasmid at -20 degree C.
Related Product Information for MT2A cdna clone
MT2A (Metallothionein 2A) belongs to lncRNA RNA class. Diseases associated with MT2A include cerebral lymphoma and prostate cancer.
Product Categories/Family for MT2A cdna clone

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
NCBI Accession #
NCBI GenBank Nucleotide #
UniProt Accession #
NCBI Official Full Name
metallothionein-2
NCBI Official Synonym Full Names
metallothionein 2A
NCBI Official Symbol
MT2A
NCBI Official Synonym Symbols
MT2; MT-2; MT-II
NCBI Protein Information
metallothionein-2
UniProt Protein Name
Metallothionein-2
Protein Family
UniProt Gene Name
MT2A
UniProt Synonym Gene Names
CES1; MT2; MT-2; MT-II
UniProt Entry Name
MT2_HUMAN

NCBI Description

This gene is a member of the metallothionein family of genes. Proteins encoded by this gene family are low in molecular weight, are cysteine-rich, lack aromatic residues, and bind divalent heavy metal ions, altering the intracellular concentration of heavy metals in the cell. These proteins act as anti-oxidants, protect against hydroxyl free radicals, are important in homeostatic control of metal in the cell, and play a role in detoxification of heavy metals. The encoded protein interacts with the protein encoded by the homeobox containing 1 gene in some cell types, controlling intracellular zinc levels, affecting apoptotic and autophagy pathways. Some polymorphisms in this gene are associated with an increased risk of cancer. [provided by RefSeq, Sep 2017]

Uniprot Description

MT2A: Metallothioneins have a high content of cysteine residues that bind various heavy metals; these proteins are transcriptionally regulated by both heavy metals and glucocorticoids. Belongs to the metallothionein superfamily. Type 1 family.

Protein type: Carrier

Chromosomal Location of Human Ortholog: 16q13

Cellular Component: perinuclear region of cytoplasm; cytoplasm; nucleus; cytosol

Molecular Function: protein binding; zinc ion binding; drug binding

Biological Process: cellular copper ion homeostasis; cytokine and chemokine mediated signaling pathway; negative regulation of growth

Research Articles on MT2A

Similar Products

Product Notes

The MT2A mt2a (Catalog #AAA201013) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: Nucleotide Sequence: ATGGATCCCA ACTGCTCCTG CGCCGCCGGT GACTCCTGCA CCTGCGCCGG CTCCTGCAAA TGCAAAGAGT GCAAATGCAC CTCCTGCAAG AAAAGCTGCT GCTCCTGCTG CCCTGTGGGC TGTGCCAAGT GTGCCCAGGG CTGCATCTGC AAAGGGGCGT CGGACAAGTG CAGCTGCTGC GCCTGA Transl ation Sequence: MDPNCSCAAG DSCTCAGSCK CKECKCTSCK KSCCSCCPVG CAKCAQGCIC KGASDKCSCC A. It is sometimes possible for the material contained within the vial of "MT2A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.