Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MSRA cdna clone

MSRA cDNA Clone

Gene Names
MSRA; PMSR
Synonyms
MSRA; MSRA cDNA Clone; MSRA cdna clone
Ordering
For Research Use Only!
Sequence
atgctctcggccacccggagggcttgccagctcctcctcctccacagcctctttcccgtcccgaggatgggcaactcggcctcgaacatcgtcagcccccaggaggccttgccgggccggaaggaacagacccctgtagcggccaaacatcatgtcaatggcaacagaacagtcgaacctttcccagagggaacacagatggctgtatttggaatgggatgtttctggggagctgaaaggaaattctgggtcttgaaaggagtgtattcaactcaagttggttttgcaggaggctatacttcaaatcctacttataaagaagtctgctcagaaaaaactggccatgcagaagtcgtccgagtggtgtaccagccagaacacatgagttttgaggaactgctcaaggtcttctgggagaatcacgacccgacccaaggtatgcgccaggggaacgaccatggcactcagtaccgctcggccatctacccgacctctgccaagcaaatggaggcagccctgagctccaaagagaactaccaaaaggttctttcagagcacggcttcggccccatcactaccgacatccgggagggacagactttctactatgcggaagactaccaccagcagtacctgagcaagaaccccaatggctactgcggccttgggggcaccggcgtgtcctgcccagtgggtattaaaaaataa
Sequence Length
708
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
23,627 Da
NCBI Official Full Name
Homo sapiens methionine sulfoxide reductase A, mRNA
NCBI Official Synonym Full Names
methionine sulfoxide reductase A
NCBI Official Symbol
MSRA
NCBI Official Synonym Symbols
PMSR
NCBI Protein Information
mitochondrial peptide methionine sulfoxide reductase
UniProt Protein Name
Mitochondrial peptide methionine sulfoxide reductase
UniProt Gene Name
MSRA
UniProt Synonym Gene Names
Peptide Met(O) reductase; PMSR
UniProt Entry Name
MSRA_HUMAN

NCBI Description

This gene encodes a ubiquitous and highly conserved protein that carries out the enzymatic reduction of methionine sulfoxide to methionine. Human and animal studies have shown the highest levels of expression in kidney and nervous tissue. The protein functions in the repair of oxidatively damaged proteins to restore biological activity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]

Uniprot Description

MSRA: Has an important function as a repair enzyme for proteins that have been inactivated by oxidation. Catalyzes the reversible oxidation-reduction of methionine sulfoxide in proteins to methionine. Belongs to the MsrA Met sulfoxide reductase family. 5 isoforms of the human protein are produced by alternative promoter.

Protein type: Mitochondrial; EC 1.8.4.11; Oxidoreductase

Chromosomal Location of Human Ortholog: 8p23.1

Cellular Component: actin cytoskeleton; cytoplasm; cytosol; nucleoplasm

Molecular Function: peptide-methionine-(S)-S-oxide reductase activity

Biological Process: methionine metabolic process; protein modification process; protein repair

Research Articles on MSRA

Similar Products

Product Notes

The MSRA msra (Catalog #AAA1277390) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctctcgg ccacccggag ggcttgccag ctcctcctcc tccacagcct ctttcccgtc ccgaggatgg gcaactcggc ctcgaacatc gtcagccccc aggaggcctt gccgggccgg aaggaacaga cccctgtagc ggccaaacat catgtcaatg gcaacagaac agtcgaacct ttcccagagg gaacacagat ggctgtattt ggaatgggat gtttctgggg agctgaaagg aaattctggg tcttgaaagg agtgtattca actcaagttg gttttgcagg aggctatact tcaaatccta cttataaaga agtctgctca gaaaaaactg gccatgcaga agtcgtccga gtggtgtacc agccagaaca catgagtttt gaggaactgc tcaaggtctt ctgggagaat cacgacccga cccaaggtat gcgccagggg aacgaccatg gcactcagta ccgctcggcc atctacccga cctctgccaa gcaaatggag gcagccctga gctccaaaga gaactaccaa aaggttcttt cagagcacgg cttcggcccc atcactaccg acatccggga gggacagact ttctactatg cggaagacta ccaccagcag tacctgagca agaaccccaa tggctactgc ggccttgggg gcaccggcgt gtcctgccca gtgggtatta aaaaataa. It is sometimes possible for the material contained within the vial of "MSRA, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.