MID2 cdna clone
MID2 cDNA Clone
Gene Names
MID2; FXY2; RNF60; TRIM1; MRX101
Synonyms
MID2; MID2 cDNA Clone; MID2 cdna clone
Sequence
atggaaacactggagtctgaattgacctgtccaatctgcctagagttgtttgaagacccccttctgctcccttgtgctcacagcctctgcttcagctgtgcccatcgcattttggtatcaagctgcagctctggtgaatccattgaacccattactgctttccagtgtcctacctgcaggtatgttatctcgctgaaccaccggggcctggatggcctcaagaggaatgtgactctgcagaacattattgatcgcttccagaaggcttcagtcagtgggcccaattcccctagtgagagccgccgggaaaggacttacaggcccaccactgccatgtctagcgagcgaattgcttgccaattctgtgagcaggacccgccaagggatgcagtaaaaacatgcatcacctgtgaggtctcctactgtgaccgttgcctgcgggccacgcaccccaacaagaaacctttcaccagccaccgcctggtggaaccagtgccagacacacatcttcgagggatcacctgcctggaccatgagaatgagaaagtgaacatgtactgtgtatctgatgaccaattgatctgtgccttatgcaaactggtgggtcgtcaccgagaccatcaggtcgcatccctgaatgatcgatttgagaaactcaagcaaactctggagatgaacctcaccaacctggttaagcgcaacagcgaactagaaaatcaaatggccaaactaatacagatctgccagcaggttgaggtgaatactgctatgcatgaggcaaaacttatggaagaatgtgacgagttggtagagatcatccagcagaggaagcaaatgatcgctgtcaaaatcaaagagacaaaggttatgaaactgagaaagttggcacagcaggttgctaattgccgccagtgtcttgaacggtcaacagtcctcatcaaccaagctgagcatatcctgaaagaaaatgaccaggcacggtttctacagtctgcaaaaaatattgctgagagggtcgctatggcaactgcatcttctcaagttctgattccagacatcaattttaatgatgcctttgaaaactttgctttagatttttccagagaaaagaaactgctagaggggttagattatttaacagccccaaacccaccatctatccgagaagaactctgtactgcctcccatgacaccattacagtccactggatctcggatgatgagttcagcatcagctcctatgagcttcagtacaccatattcactggccaggctaacttcatcagcctgtataattcagtagacagctggatgattgttcccaacattaaacagaaccattacacagtgcatggactccagagcgggactcgctacatcttcatcgttaaagccataaaccaagccggcagccggaacagtgaacctacccgactaaaaacaaacagccaaccctttaaattggatcccaaaatgactcacaagaagttgaagatctccaatgatggattgcagatggagaaggatgaaagctctctaaagaagagccacaccccagagaggtttagtggcacagggtgctatggggcagcaggaaatatattcattgacagtggctgccactattgggaggtggtcatgggttcctcaacatggtatgcaattggcattgcctacaaatcagctccaaagaatgaatggattggcaagaatgcctcctcatgggtcttctctcgctgcaatagtaacttcgtggtgagacacaacaacaaggaaatgctggtggatgtgcccccacacctgaagcgtctgggtgtcctcctggattatgacaacaatatgctgtctttctatgacccagctaactctctccatcttcatacttttgatgtgaccttcattcttccagtttgtccaacatttacaatctggaacaaatccctaatgatcctgtctggcttgcctgccccagattttattgattaccctgagcggcaggaatgcaactgcaggcctcaagaatccccttatgtttctgggatgaaaacctgtcattaa
Sequence Length
2058
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
79,865 Da
NCBI Official Full Name
Homo sapiens midline 2, mRNA
NCBI Official Synonym Full Names
midline 2
NCBI Official Symbol
MID2
NCBI Official Synonym Symbols
FXY2; RNF60; TRIM1; MRX101
NCBI Protein Information
probable E3 ubiquitin-protein ligase MID2
UniProt Protein Name
Probable E3 ubiquitin-protein ligase MID2
Protein Family
UniProt Gene Name
MID2
UniProt Synonym Gene Names
FXY2; RNF60; TRIM1
UniProt Entry Name
TRIM1_HUMAN
NCBI Description
The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to microtubular structures in the cytoplasm. Alternate splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Feb 2009]
Uniprot Description
MID2: is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to microtubular structures in the cytoplasm. Alternate splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Feb 2009]
Protein type: EC 6.3.2.-; Ubiquitin conjugating system; Microtubule-binding
Chromosomal Location of Human Ortholog: Xq22.3
Cellular Component: microtubule
Molecular Function: microtubule binding; phosphoprotein binding; protein heterodimerization activity; protein homodimerization activity
Biological Process: activation of NF-kappaB transcription factor; innate immune response; negative regulation of viral transcription; negative regulation of virion penetration into host cell; positive regulation of autophagy; positive regulation of I-kappaB kinase/NF-kappaB cascade; positive regulation of transcription factor activity
Disease: Mental Retardation, X-linked 101
Research Articles on MID2
Similar Products
Product Notes
The MID2 mid2 (Catalog #AAA1274468) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaaacac tggagtctga attgacctgt ccaatctgcc tagagttgtt tgaagacccc cttctgctcc cttgtgctca cagcctctgc ttcagctgtg cccatcgcat tttggtatca agctgcagct ctggtgaatc cattgaaccc attactgctt tccagtgtcc tacctgcagg tatgttatct cgctgaacca ccggggcctg gatggcctca agaggaatgt gactctgcag aacattattg atcgcttcca gaaggcttca gtcagtgggc ccaattcccc tagtgagagc cgccgggaaa ggacttacag gcccaccact gccatgtcta gcgagcgaat tgcttgccaa ttctgtgagc aggacccgcc aagggatgca gtaaaaacat gcatcacctg tgaggtctcc tactgtgacc gttgcctgcg ggccacgcac cccaacaaga aacctttcac cagccaccgc ctggtggaac cagtgccaga cacacatctt cgagggatca cctgcctgga ccatgagaat gagaaagtga acatgtactg tgtatctgat gaccaattga tctgtgcctt atgcaaactg gtgggtcgtc accgagacca tcaggtcgca tccctgaatg atcgatttga gaaactcaag caaactctgg agatgaacct caccaacctg gttaagcgca acagcgaact agaaaatcaa atggccaaac taatacagat ctgccagcag gttgaggtga atactgctat gcatgaggca aaacttatgg aagaatgtga cgagttggta gagatcatcc agcagaggaa gcaaatgatc gctgtcaaaa tcaaagagac aaaggttatg aaactgagaa agttggcaca gcaggttgct aattgccgcc agtgtcttga acggtcaaca gtcctcatca accaagctga gcatatcctg aaagaaaatg accaggcacg gtttctacag tctgcaaaaa atattgctga gagggtcgct atggcaactg catcttctca agttctgatt ccagacatca attttaatga tgcctttgaa aactttgctt tagatttttc cagagaaaag aaactgctag aggggttaga ttatttaaca gccccaaacc caccatctat ccgagaagaa ctctgtactg cctcccatga caccattaca gtccactgga tctcggatga tgagttcagc atcagctcct atgagcttca gtacaccata ttcactggcc aggctaactt catcagcctg tataattcag tagacagctg gatgattgtt cccaacatta aacagaacca ttacacagtg catggactcc agagcgggac tcgctacatc ttcatcgtta aagccataaa ccaagccggc agccggaaca gtgaacctac ccgactaaaa acaaacagcc aaccctttaa attggatccc aaaatgactc acaagaagtt gaagatctcc aatgatggat tgcagatgga gaaggatgaa agctctctaa agaagagcca caccccagag aggtttagtg gcacagggtg ctatggggca gcaggaaata tattcattga cagtggctgc cactattggg aggtggtcat gggttcctca acatggtatg caattggcat tgcctacaaa tcagctccaa agaatgaatg gattggcaag aatgcctcct catgggtctt ctctcgctgc aatagtaact tcgtggtgag acacaacaac aaggaaatgc tggtggatgt gcccccacac ctgaagcgtc tgggtgtcct cctggattat gacaacaata tgctgtcttt ctatgaccca gctaactctc tccatcttca tacttttgat gtgaccttca ttcttccagt ttgtccaaca tttacaatct ggaacaaatc cctaatgatc ctgtctggct tgcctgcccc agattttatt gattaccctg agcggcagga atgcaactgc aggcctcaag aatcccctta tgtttctggg atgaaaacct gtcattaa. It is sometimes possible for the material contained within the vial of "MID2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
