Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MICA cdna clone

MICA cDNA Clone

Synonyms
MICA; MICA cDNA Clone; MICA cdna clone
Ordering
For Research Use Only!
Sequence
atggggctgggcccggtcttcctgcttctggctggcatcttcccttttgcacctccgggagctgctgctgagccccacagtcttcgttataacctcacggtgctgtcctgggatggatctgtgcagtcagggtttctcactgaggtacatctggatggtcagcccttcctgcgctgtgacaggcagaaatgcagggcaaagccccagggacagtgggcagaagatgtcctgggaaataagacatgggacagagagaccagagacttgacagggaacggaaaggacctcaggatgaccctggctcatatcaaggaccagaaagaaggcttgcattccctccaggagattagggtctgtgagatccatgaagacaacagcaccaggagctcccagcatttctactacgatggggagctcttcctctcccaaaacctggagactgaggaatggacaatgccccagtcctccagagctcagaccttggccatgaacgtcaggaatttcttgaaggaagatgccatgaagaccaagacacactatcacgctatgcatgcagactgcctgcaggaactacggcgatatctaaaatccggcgtagtcctgaggagaacagtgccccccatggtgaatgtcacccgcagcgaggcctcagagggcaacattaccgtgacatgcagggcttctggcttctatccctggaatatcacactgagctggcgtcaggatggggtatctttgagccacgacacccagcagtggggggatgtcctgcctgatgggaatggaacctaccagacctgggtggccaccaggatttgccaaggagaggagcagaggttcacctgctacatggaacacagcgggaatcacagcactcaccctgtgccctctgggaaagtgctggtgcttcagagtcattggcagacattccatgtttctgctgttgctgctgctgctatttttgttattattattttctatgtccgttgttgtaagaagaaaacatcagctgcagagggtccagagctcgtgagcctgcaggtcctggatcaacacccagttgggacgagtgaccacagggatgccacacagctcggatttcagcctctgatgtcagatcttgggtccactggctccactgagggcacctag
Sequence Length
1152
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
31,577 Da
NCBI Official Full Name
Homo sapiens MHC class I polypeptide-related sequence A, mRNA
UniProt Protein Name
MHC class I polypeptide-related sequence A
Protein Family
UniProt Gene Name
MICA
UniProt Synonym Gene Names
MIC-A
UniProt Entry Name
MICA_HUMAN

Uniprot Description

MICA: Seems to have no role in antigen presentation. Acts as a stress-induced self-antigen that is recognized by gamma delta T- cells. Ligand for the KLRK1/NKG2D receptor. Binding to KLRK1 leads to cell lysis. Anti-MICA antibodies and ligand shedding are involved in the progression of monoclonal gammopathy of undetermined significance (MGUS)to multiple myeloma. Genetic variations in MICA may be a cause of susceptibility to psoriasis type 1 (PSORS1). Psoriasis is a common, chronic inflammatory disease of the skin with multifactorial etiology. It is characterized by red, scaly plaques usually found on the scalp, elbows and knees. These lesions are caused by abnormal keratinocyte proliferation and infiltration of inflammatory cells into the dermis and epidermis. Genetic variation in MICA is a cause of susceptibility to psoriatic arthritis (PSORAS). PSORAS is an inflammatory, seronegative arthritis associated with psoriasis. It is a heterogeneous disorder ranging from a mild, non-destructive disease to a severe, progressive, erosive arthropathy. Five types of psoriatic arthritis have been defined: asymmetrical oligoarthritis characterized by primary involvement of the small joints of the fingers or toes; asymmetrical arthritis which involves the joints of the extremities; symmetrical polyarthritis characterized by a rheumatoidlike pattern that can involve hands, wrists, ankles, and feet; arthritis mutilans, which is a rare but deforming and destructive condition; arthritis of the sacroiliac joints and spine (psoriatic spondylitis). Belongs to the MHC class I family. MIC subfamily. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 6p21.33

Cellular Component: cell surface; extracellular space; integral to plasma membrane; plasma membrane

Molecular Function: antigen binding; beta-2-microglobulin binding; natural killer cell lectin-like receptor binding; protein binding

Biological Process: antigen processing and presentation; defense response to bacterium; defense response to virus; gamma-delta T cell activation; immune response to tumor cell; natural killer cell mediated cytotoxicity; negative regulation of natural killer cell activation; negative regulation of natural killer cell mediated cytotoxicity; regulation of immune response; response to DNA damage stimulus; response to heat; T cell mediated cytotoxicity

Disease: Psoriasis 1, Susceptibility To; Psoriatic Arthritis, Susceptibility To

Similar Products

Product Notes

The MICA mica (Catalog #AAA1267710) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggggctgg gcccggtctt cctgcttctg gctggcatct tcccttttgc acctccggga gctgctgctg agccccacag tcttcgttat aacctcacgg tgctgtcctg ggatggatct gtgcagtcag ggtttctcac tgaggtacat ctggatggtc agcccttcct gcgctgtgac aggcagaaat gcagggcaaa gccccaggga cagtgggcag aagatgtcct gggaaataag acatgggaca gagagaccag agacttgaca gggaacggaa aggacctcag gatgaccctg gctcatatca aggaccagaa agaaggcttg cattccctcc aggagattag ggtctgtgag atccatgaag acaacagcac caggagctcc cagcatttct actacgatgg ggagctcttc ctctcccaaa acctggagac tgaggaatgg acaatgcccc agtcctccag agctcagacc ttggccatga acgtcaggaa tttcttgaag gaagatgcca tgaagaccaa gacacactat cacgctatgc atgcagactg cctgcaggaa ctacggcgat atctaaaatc cggcgtagtc ctgaggagaa cagtgccccc catggtgaat gtcacccgca gcgaggcctc agagggcaac attaccgtga catgcagggc ttctggcttc tatccctgga atatcacact gagctggcgt caggatgggg tatctttgag ccacgacacc cagcagtggg gggatgtcct gcctgatggg aatggaacct accagacctg ggtggccacc aggatttgcc aaggagagga gcagaggttc acctgctaca tggaacacag cgggaatcac agcactcacc ctgtgccctc tgggaaagtg ctggtgcttc agagtcattg gcagacattc catgtttctg ctgttgctgc tgctgctatt tttgttatta ttattttcta tgtccgttgt tgtaagaaga aaacatcagc tgcagagggt ccagagctcg tgagcctgca ggtcctggat caacacccag ttgggacgag tgaccacagg gatgccacac agctcggatt tcagcctctg atgtcagatc ttgggtccac tggctccact gagggcacct ag. It is sometimes possible for the material contained within the vial of "MICA, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.