Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

LPAR4 cdna clone

LPAR4 cDNA Clone

Gene Names
LPAR4; LPA4; P2Y9; GPR23; P2RY9; P2Y5-LIKE
Synonyms
LPAR4; LPAR4 cDNA Clone; LPAR4 cdna clone
Ordering
For Research Use Only!
Sequence
atgggtgacagaagattcattgacttccaattccaagattcaaattcaagcctcagacccaggttgggcaatgctactgccaataatacttgcattgttgatgattccttcaagtataatctcaatggtgctgtctacagtgttgcattcatcttgggtctgataaccaacagtgtctctctgtttgtcttctgtttccgcatgaaaatgagaagtgagactgctatttttatcaccaatctagctgtctctgatttgctttttgtctgtacactaccttttaaaatattttacaacttcaaccgccactggccttttggtgacaccctctgcaagatctctggaactgcattccttaccaacatctatgggagcatgctctttctcacctgtattagtgtggatcgtttcctggccattgtctatccttttcgatctcgtactattaggactaggaggaattctgccattgtgtgtgctggtgtctggatcctagtcctcagtggcggtatttcagcctctttgttttccaccactaatgtcaacaatgcaaccaccacctgctttgaaggcttctccaaacgtgtctggaagacttatttatccaagatcacaatatttattgaagttgttgggtttatcattcctctaatattgaatgtctcttgctcttctgtggtgctgagaactcttcgcaagcctgctactctgtctcaaattgggaccaataagaaaaaagtactgaaaatgatcacagtacatatggcagtctttgtggtatgctttgtaccctacaactctgtcctcttcttgtatgccctggtgcgctcccaagctattactaattgctttttggaaagatttgcaaagatcatgtacccaatcaccttgtgccttgcaactctgaactgttgttttgaccctttcatctattacttcacccttgaatcctttcagaagtccttctacatcaatgcccacatcagaatggagtccctgtttaagactgaaacacctttgaccacaaagccttcccttccagctattcaagaggaagtgagtgatcaaacaacaaataatggtggtgaattaatgctagaatccaccttttag
Sequence Length
1113
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
41,895 Da
NCBI Official Full Name
Homo sapiens lysophosphatidic acid receptor 4, mRNA
NCBI Official Synonym Full Names
lysophosphatidic acid receptor 4
NCBI Official Symbol
LPAR4
NCBI Official Synonym Symbols
LPA4; P2Y9; GPR23; P2RY9; P2Y5-LIKE
NCBI Protein Information
lysophosphatidic acid receptor 4
UniProt Protein Name
Lysophosphatidic acid receptor 4
UniProt Gene Name
LPAR4
UniProt Synonym Gene Names
GPR23; LPA4; P2RY9; LPA receptor 4; LPA-4; P2Y9
UniProt Entry Name
LPAR4_HUMAN

NCBI Description

This gene encodes a member of the lysophosphatidic acid receptor family. It may also be related to the P2Y receptors, a family of receptors that bind purine and pyrimidine nucleotides and are coupled to G proteins. The encoded protein may play a role in monocytic differentiation. [provided by RefSeq, Feb 2009]

Uniprot Description

LPAR4: Receptor for lysophosphatidic acid (LPA), a mediator of diverse cellular activities. Transduces a signal by increasing the intracellular calcium ions and by stimulating adenylyl cyclase activity. The rank order of potency for agonists of this receptor is 1-oleoyl- > 1-stearoyl- > 1-palmitoyl- > 1-myristoyl- > 1- alkyl- > 1-alkenyl-LPA. Belongs to the G-protein coupled receptor 1 family.

Protein type: Membrane protein, integral; Receptor, GPCR; Membrane protein, multi-pass; GPCR, family 1

Chromosomal Location of Human Ortholog: Xq21.1

Cellular Component: plasma membrane

Research Articles on LPAR4

Similar Products

Product Notes

The LPAR4 lpar4 (Catalog #AAA1265905) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggtgaca gaagattcat tgacttccaa ttccaagatt caaattcaag cctcagaccc aggttgggca atgctactgc caataatact tgcattgttg atgattcctt caagtataat ctcaatggtg ctgtctacag tgttgcattc atcttgggtc tgataaccaa cagtgtctct ctgtttgtct tctgtttccg catgaaaatg agaagtgaga ctgctatttt tatcaccaat ctagctgtct ctgatttgct ttttgtctgt acactacctt ttaaaatatt ttacaacttc aaccgccact ggccttttgg tgacaccctc tgcaagatct ctggaactgc attccttacc aacatctatg ggagcatgct ctttctcacc tgtattagtg tggatcgttt cctggccatt gtctatcctt ttcgatctcg tactattagg actaggagga attctgccat tgtgtgtgct ggtgtctgga tcctagtcct cagtggcggt atttcagcct ctttgttttc caccactaat gtcaacaatg caaccaccac ctgctttgaa ggcttctcca aacgtgtctg gaagacttat ttatccaaga tcacaatatt tattgaagtt gttgggttta tcattcctct aatattgaat gtctcttgct cttctgtggt gctgagaact cttcgcaagc ctgctactct gtctcaaatt gggaccaata agaaaaaagt actgaaaatg atcacagtac atatggcagt ctttgtggta tgctttgtac cctacaactc tgtcctcttc ttgtatgccc tggtgcgctc ccaagctatt actaattgct ttttggaaag atttgcaaag atcatgtacc caatcacctt gtgccttgca actctgaact gttgttttga ccctttcatc tattacttca cccttgaatc ctttcagaag tccttctaca tcaatgccca catcagaatg gagtccctgt ttaagactga aacacctttg accacaaagc cttcccttcc agctattcaa gaggaagtga gtgatcaaac aacaaataat ggtggtgaat taatgctaga atccaccttt tag. It is sometimes possible for the material contained within the vial of "LPAR4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.