Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

KLF12 cdna clone

KLF12 cDNA Clone

Gene Names
KLF12; AP2REP; AP-2rep; HSPC122
Synonyms
KLF12; KLF12 cDNA Clone; KLF12 cdna clone
Ordering
For Research Use Only!
Sequence
atgaatatccatatgaagagaaaaacaataaagaatatcaacacctttgagaacagaatgttaatgcttgatgggatgccggcagtcagagtcaaaacagagcttttggaatctgaacaagggtctccaaacgtccacaactatcccgatatggaagccgttcccctgttgctaaataatgtgaaaggggagcccccggaggactcgttatctgtagatcacttccaaacacaaactgagccagtggacttgtcaataaacaaagccaggacgtcccctactgccgtttcatcctccccagtttccatgacagcatctgcctcctcaccttcttcaacttcaacctcttcatcgtcttctagtcgtctagcctcatccccaactgttatcacatcagtatcttcagcgtcatcttcgtcaacagtattaactccagggccccttgtggcctctgcatctggtgttggaggccagcagtttttgcacattatccatcccgtaccgccttcaagtcccatgaatttacagtctaacaaactgagtcatgttcaccgcatccccgtggtggtacagtcggtgcctgttgtctacacagctgtaaggtcacctggaaatgtgaacaacactattgtcgtgccgcttttggaggatgggagaggccatggcaaagcacaaatggacccccgaggcctatctcccagacaaagtaaaagtgacagtgatgatgatgacctgccaaatgtgaccttagatagcgttaatgaaactggatctacggccctttccatagccagagcagtacaagaggtacatccgtccccagtatcaagggtccggggaaatcgaatgaataatcaaaagtttccttgttcaatttcaccatttagtattgagagcacaagacgccagagacggtctgaatccccagactccagaaaacggcgtatccacagatgtgattttgagggatgcaacaaagtgtacacaaaaagttctcacctgaaggctcaccggaggacacatacaggagagaaaccttacaagtgtacctgggaaggctgcacctggaagttcgctcgttcagatgaactgacgaggcattaccgcaaacatacgggagtgaagccattcaagtgcgcggactgtgatcgcagcttttcccggtcagatcatttggccctgcaccgccggaggcatatgttggtgtga
Sequence Length
1209
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
33,250 Da
NCBI Official Full Name
Homo sapiens Kruppel-like factor 12, mRNA
NCBI Official Synonym Full Names
Kruppel like factor 12
NCBI Official Symbol
KLF12
NCBI Official Synonym Symbols
AP2REP; AP-2rep; HSPC122
NCBI Protein Information
Krueppel-like factor 12
UniProt Protein Name
Krueppel-like factor 12
Protein Family
UniProt Gene Name
KLF12
UniProt Synonym Gene Names
AP2REP
UniProt Entry Name
KLF12_HUMAN

NCBI Description

Activator protein-2 alpha (AP-2 alpha) is a developmentally-regulated transcription factor and important regulator of gene expression during vertebrate development and carcinogenesis. The protein encoded by this gene is a member of the Kruppel-like zinc finger protein family and can repress expression of the AP-2 alpha gene by binding to a specific site in the AP-2 alpha gene promoter. Repression by the encoded protein requires binding with a corepressor, CtBP1. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

KLF12: Confers strong transcriptional repression to the AP-2- alpha gene. Binds to a regulatory element (A32) in the AP-2-alpha gene promoter. Belongs to the Sp1 C2H2-type zinc-finger protein family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral; DNA-binding; C2H2-type zinc finger protein

Chromosomal Location of Human Ortholog: 13q22

Cellular Component: cytoplasm; nucleoplasm

Molecular Function: DNA binding; protein binding; transcription corepressor activity; transcription factor activity

Biological Process: negative regulation of transcription from RNA polymerase II promoter; regulation of transcription from RNA polymerase II promoter

Research Articles on KLF12

Similar Products

Product Notes

The KLF12 klf12 (Catalog #AAA1277927) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaatatcc atatgaagag aaaaacaata aagaatatca acacctttga gaacagaatg ttaatgcttg atgggatgcc ggcagtcaga gtcaaaacag agcttttgga atctgaacaa gggtctccaa acgtccacaa ctatcccgat atggaagccg ttcccctgtt gctaaataat gtgaaagggg agcccccgga ggactcgtta tctgtagatc acttccaaac acaaactgag ccagtggact tgtcaataaa caaagccagg acgtccccta ctgccgtttc atcctcccca gtttccatga cagcatctgc ctcctcacct tcttcaactt caacctcttc atcgtcttct agtcgtctag cctcatcccc aactgttatc acatcagtat cttcagcgtc atcttcgtca acagtattaa ctccagggcc ccttgtggcc tctgcatctg gtgttggagg ccagcagttt ttgcacatta tccatcccgt accgccttca agtcccatga atttacagtc taacaaactg agtcatgttc accgcatccc cgtggtggta cagtcggtgc ctgttgtcta cacagctgta aggtcacctg gaaatgtgaa caacactatt gtcgtgccgc ttttggagga tgggagaggc catggcaaag cacaaatgga cccccgaggc ctatctccca gacaaagtaa aagtgacagt gatgatgatg acctgccaaa tgtgacctta gatagcgtta atgaaactgg atctacggcc ctttccatag ccagagcagt acaagaggta catccgtccc cagtatcaag ggtccgggga aatcgaatga ataatcaaaa gtttccttgt tcaatttcac catttagtat tgagagcaca agacgccaga gacggtctga atccccagac tccagaaaac ggcgtatcca cagatgtgat tttgagggat gcaacaaagt gtacacaaaa agttctcacc tgaaggctca ccggaggaca catacaggag agaaacctta caagtgtacc tgggaaggct gcacctggaa gttcgctcgt tcagatgaac tgacgaggca ttaccgcaaa catacgggag tgaagccatt caagtgcgcg gactgtgatc gcagcttttc ccggtcagat catttggccc tgcaccgccg gaggcatatg ttggtgtga. It is sometimes possible for the material contained within the vial of "KLF12, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.