Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ILK cdna clone

ILK cDNA Clone

Gene Names
ILK; P59; ILK-1; ILK-2; p59ILK; HEL-S-28
Synonyms
ILK; ILK cDNA Clone; ILK cdna clone
Ordering
For Research Use Only!
Sequence
atggacgacattttcactcagtgccgggagggcaacgcagtcgccgttcgcctgtggctggacaacacggagaacgacctcaaccagggggacgatcatggcttctcccccttgcactgggcctgccgagagggccgctctgctgtggttgagatgttgatcatgcggggggcacggatcaatgtaatgaaccgtggggatgacacccccctgcatctggcagccagtcatggacaccgtgatattgtacagaagctattgcagtacaaggcagacatcaatgcagtgaatgaacatgggaatgtgcccctgcactatgcctgtttttggggccaagatcaagtggcagaggacctggtggcaaatggggcccttgtcagcatctgtaacaagtatggagagatgcctgtggacaaagccaaggcacccctgagagagcttctccgagagcgggcagagaagatgggccagaatctcaaccgtattccatacaaggacacattctggaaggggaccacccgcactcggccccgaaatggaaccctgaacaaacactctggcattgacttcaaacagcttaacttcctgacgaagctcaacgagaatcactctggagagctatggaagggccgctggcagggcaatgacattgtcgtgaaggtgctgaaggttcgagactggagtacaaggaagagcagggacttcaatgaagagtgtccccggctcaggattttctcgcatccaaatgtgctcccagtgctaggtgcctgccagtctccacctgctcctcatcctactctcatcacacactggatgccatatggatccctctacaatgtactacatgaaggcaccaatttcgtcgtggaccagagccaggctgtgaagtttgctttggacatggcaaggggcatggccttcctacacacactagagcccctcatcccacgacatgcactcaatagccgtagtgtaatgattgatgaggacatgactgcccgaattagcatggctgatgtcaagttctctttccaatgtcctggtcgcatgtatgcacctgcctgggtagcccccgaagctctgcagaagaagcctgaagacacaaacagacgctcagcagacatgtggagttttgcagtgcttctgtgggaactggtgacacgggaggtaccctttgctgacctctccaatatggagattggaatgaaggtggcattggaaggccttcggcctaccatcccaccaggtatttcccctcatgtgtgtaagctcatgaagatctgcatgaatgaagaccctgcaaagcgacccaaatttgacatgattgtgcctatccttgagaagatgcaggacaagtag
Sequence Length
1359
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
36,467 Da
NCBI Official Full Name
Homo sapiens integrin-linked kinase, mRNA
NCBI Official Synonym Full Names
integrin linked kinase
NCBI Official Symbol
ILK
NCBI Official Synonym Symbols
P59; ILK-1; ILK-2; p59ILK; HEL-S-28
NCBI Protein Information
integrin-linked protein kinase
UniProt Protein Name
Integrin-linked protein kinase
UniProt Gene Name
ILK
UniProt Synonym Gene Names
ILK1; ILK2
UniProt Entry Name
ILK_HUMAN

NCBI Description

This gene encodes a protein with a kinase-like domain and four ankyrin-like repeats. The encoded protein associates at the cell membrane with the cytoplasmic domain of beta integrins, where it regulates integrin-mediated signal transduction. Activity of this protein is important in the epithelial to mesenchymal transition, and over-expression of this gene is implicated in tumor growth and metastasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]

Uniprot Description

ILK: a tyrosine kinase-like kinase of the MLK family. Couples integrins and growth factors to downstream pathways involved in cell survival, cell cycle control, cell-cell adhesion and cell motility. Functions as a scaffold bridging the extra-cellular matrix and growth factor receptors to the actin cytoskeleton through interactions with the ILK-PINCH complex. This complex, which includes integrin, PINCH (which links ILK to receptor tyrosine kinases via Nck2), PARVA and affixin, is considered to be one of the convergence points of integrin- and growth factor-signaling pathways. May be implicated in mediating cell architecture, adhesion to integrin substrates and anchorage-dependent growth in epithelial cells. Stimulated downstream of PI3 kinase. Increased expression is correlated with progression of several tumor types, including breast, prostate, and colon carcinomas. Overexpression drives anchorage-independent growth and faster cell cycle.

Protein type: Kinase, protein; EC 2.7.11.1; Protein kinase, TKL; Protein kinase, Ser/Thr (non-receptor); TKL group; MLK family; ILK subfamily

Chromosomal Location of Human Ortholog: 11p15.4

Cellular Component: cell junction; cytoplasm; cytosol; focal adhesion; membrane; nucleoplasm

Molecular Function: protein binding; protein kinase binding; protein serine/threonine kinase activity

Biological Process: cell-matrix adhesion; integrin-mediated signaling pathway; positive regulation of phosphorylation; positive regulation of transcription, DNA-dependent; protein amino acid phosphorylation

Research Articles on ILK

Similar Products

Product Notes

The ILK ilk (Catalog #AAA1268693) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacgaca ttttcactca gtgccgggag ggcaacgcag tcgccgttcg cctgtggctg gacaacacgg agaacgacct caaccagggg gacgatcatg gcttctcccc cttgcactgg gcctgccgag agggccgctc tgctgtggtt gagatgttga tcatgcgggg ggcacggatc aatgtaatga accgtgggga tgacaccccc ctgcatctgg cagccagtca tggacaccgt gatattgtac agaagctatt gcagtacaag gcagacatca atgcagtgaa tgaacatggg aatgtgcccc tgcactatgc ctgtttttgg ggccaagatc aagtggcaga ggacctggtg gcaaatgggg cccttgtcag catctgtaac aagtatggag agatgcctgt ggacaaagcc aaggcacccc tgagagagct tctccgagag cgggcagaga agatgggcca gaatctcaac cgtattccat acaaggacac attctggaag gggaccaccc gcactcggcc ccgaaatgga accctgaaca aacactctgg cattgacttc aaacagctta acttcctgac gaagctcaac gagaatcact ctggagagct atggaagggc cgctggcagg gcaatgacat tgtcgtgaag gtgctgaagg ttcgagactg gagtacaagg aagagcaggg acttcaatga agagtgtccc cggctcagga ttttctcgca tccaaatgtg ctcccagtgc taggtgcctg ccagtctcca cctgctcctc atcctactct catcacacac tggatgccat atggatccct ctacaatgta ctacatgaag gcaccaattt cgtcgtggac cagagccagg ctgtgaagtt tgctttggac atggcaaggg gcatggcctt cctacacaca ctagagcccc tcatcccacg acatgcactc aatagccgta gtgtaatgat tgatgaggac atgactgccc gaattagcat ggctgatgtc aagttctctt tccaatgtcc tggtcgcatg tatgcacctg cctgggtagc ccccgaagct ctgcagaaga agcctgaaga cacaaacaga cgctcagcag acatgtggag ttttgcagtg cttctgtggg aactggtgac acgggaggta ccctttgctg acctctccaa tatggagatt ggaatgaagg tggcattgga aggccttcgg cctaccatcc caccaggtat ttcccctcat gtgtgtaagc tcatgaagat ctgcatgaat gaagaccctg caaagcgacc caaatttgac atgattgtgc ctatccttga gaagatgcag gacaagtag. It is sometimes possible for the material contained within the vial of "ILK, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.