Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

IL6 cdna clone

IL6 cDNA Clone

Gene Names
IL6; CDF; HGF; HSF; BSF2; IL-6; BSF-2; IFNB2; IFN-beta-2
Synonyms
IL6; IL6 cDNA Clone; IL6 cdna clone
Ordering
For Research Use Only!
Sequence
atgaactccttctccacaagcgccttcggtccagttgccttctccctggggctgctcctggtgttgcctgctgccttccctgccccagtacccccaggagaagattccaaagatgtagccgccccacacagacagccactcacctcttcagaacgaattgacaaacaaattcggtacatcctcgacggcatctcagccctgagaaaggagacatgtaacaagagtaacatgtgtgaaagcagcaaagaggcactggcagaaaacaacctgaaccttccaaagatggctgaaaaagatggatgcttccaatctggattcaatgaggagacttgcctggtgaaaatcatcactggtcttttggagtttgaggtatacctagagtacctccagaacagatttgagagtagtgaggaacaagccagagctgtgcagatgagtacaaaagtcctgatccagttcctgcagaaaaaggcaaagaatctagatgcaataaccacccctgacccaaccacaaatgccagcctgctgacgaagctgcaggcacagaaccagtggctgcaggacatgacaactcatctcattctgcgcagctttaaggagttcctgcagtccagcctgagggctcttcggcaaatgtag
Sequence Length
639
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
23,718 Da
NCBI Official Full Name
Homo sapiens interleukin 6 (interferon, beta 2), mRNA
NCBI Official Synonym Full Names
interleukin 6
NCBI Official Symbol
IL6
NCBI Official Synonym Symbols
CDF; HGF; HSF; BSF2; IL-6; BSF-2; IFNB2; IFN-beta-2
NCBI Protein Information
interleukin-6
UniProt Protein Name
Interleukin-6
Protein Family
UniProt Gene Name
IL6
UniProt Synonym Gene Names
IFNB2; IL-6; BSF-2; CDF; IFN-beta-2
UniProt Entry Name
IL6_HUMAN

NCBI Description

This gene encodes a cytokine that functions in inflammation and the maturation of B cells. In addition, the encoded protein has been shown to be an endogenous pyrogen capable of inducing fever in people with autoimmune diseases or infections. The protein is primarily produced at sites of acute and chronic inflammation, where it is secreted into the serum and induces a transcriptional inflammatory response through interleukin 6 receptor, alpha. The functioning of this gene is implicated in a wide variety of inflammation-associated disease states, including suspectibility to diabetes mellitus and systemic juvenile rheumatoid arthritis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]

Uniprot Description

IL6: Cytokine with a wide variety of biological functions. It is a potent inducer of the acute phase response. Plays an essential role in the final differentiation of B-cells into Ig- secreting cells Involved in lymphocyte and monocyte differentiation. It induces myeloma and plasmacytoma growth and induces nerve cells differentiation Acts on B-cells, T-cells, hepatocytes, hematopoietic progenitor cells and cells of the CNS. Also acts as a myokine. It is discharged into the bloodstream after muscle contraction and acts to increase the breakdown of fats and to improve insulin resistance. Genetic variations in IL6 are associated with susceptibility to rheumatoid arthritis systemic juvenile (RASJ). An inflammatory articular disorder with systemic- onset beginning before the age of 16. It represents a subgroup of juvenile arthritis associated with severe extraarticular features and occasionally fatal complications. During active phases of the disorder, patients display a typical daily spiking fever, an evanescent macular rash, lymphadenopathy, hepatosplenomegaly, serositis, myalgia and arthritis. A IL6 promoter polymorphism is associated with a lifetime risk of development of Kaposi sarcoma in HIV-infected men. Belongs to the IL-6 superfamily.

Protein type: Secreted, signal peptide; Secreted

Chromosomal Location of Human Ortholog: 7p21

Cellular Component: extracellular region; extracellular space; interleukin-6 receptor complex

Molecular Function: cytokine activity; growth factor activity; interleukin-6 receptor binding; protein binding

Biological Process: activation of NF-kappaB transcription factor; acute-phase response; cytokine and chemokine mediated signaling pathway; defense response to Gram-negative bacterium; defense response to Gram-positive bacterium; defense response to virus; endocrine pancreas development; hepatic immune response; humoral immune response; inflammatory response; monocyte chemotaxis; negative regulation of apoptosis; negative regulation of chemokine biosynthetic process; negative regulation of collagen biosynthetic process; neurite development; neutrophil apoptosis; neutrophil mediated immunity; platelet activation; positive regulation of acute inflammatory response; positive regulation of apoptosis; positive regulation of B cell activation; positive regulation of cell proliferation; positive regulation of chemokine production; positive regulation of immunoglobulin secretion; positive regulation of interleukin-6 production; positive regulation of JAK-STAT cascade; positive regulation of leukocyte chemotaxis; positive regulation of MAPKKK cascade; positive regulation of osteoblast differentiation; positive regulation of peptidyl-serine phosphorylation; positive regulation of peptidyl-tyrosine phosphorylation; positive regulation of smooth muscle cell proliferation; positive regulation of T cell proliferation; positive regulation of transcription factor activity; positive regulation of transcription from RNA polymerase II promoter; positive regulation of transcription, DNA-dependent; positive regulation of translation; positive regulation of tyrosine phosphorylation of Stat3 protein; regulation of angiogenesis; response to glucocorticoid stimulus

Disease: Arteriovenous Malformations Of The Brain; Inflammatory Bowel Disease 1; Kaposi Sarcoma, Susceptibility To; Rheumatoid Arthritis, Systemic Juvenile

Research Articles on IL6

Similar Products

Product Notes

The IL6 il6 (Catalog #AAA1275445) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaactcct tctccacaag cgccttcggt ccagttgcct tctccctggg gctgctcctg gtgttgcctg ctgccttccc tgccccagta cccccaggag aagattccaa agatgtagcc gccccacaca gacagccact cacctcttca gaacgaattg acaaacaaat tcggtacatc ctcgacggca tctcagccct gagaaaggag acatgtaaca agagtaacat gtgtgaaagc agcaaagagg cactggcaga aaacaacctg aaccttccaa agatggctga aaaagatgga tgcttccaat ctggattcaa tgaggagact tgcctggtga aaatcatcac tggtcttttg gagtttgagg tatacctaga gtacctccag aacagatttg agagtagtga ggaacaagcc agagctgtgc agatgagtac aaaagtcctg atccagttcc tgcagaaaaa ggcaaagaat ctagatgcaa taaccacccc tgacccaacc acaaatgcca gcctgctgac gaagctgcag gcacagaacc agtggctgca ggacatgaca actcatctca ttctgcgcag ctttaaggag ttcctgcagt ccagcctgag ggctcttcgg caaatgtag. It is sometimes possible for the material contained within the vial of "IL6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.