Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

IL23A cdna clone

IL23A cDNA Clone

Gene Names
IL23A; P19; SGRF; IL-23; IL-23A; IL23P19
Synonyms
IL23A; IL23A cDNA Clone; IL23A cdna clone
Ordering
For Research Use Only!
Sequence
atgctggggagcagagctgtaatgctgctgttgctgctgccctggacagctcagggcagagctgtgcctgggggcagcagccctgcctggactcagtgccagcagctttcacagaagctctgcacactggcctggagtgcacatccactagtgggacacatggatctaagagaagagggagatgaagagactacaaatgatgttccccatatccagtgtggagatggctgtgacccccaaggactcagggacaacagtcagttctgcttgcaaaggatccaccagggtctgattttttatgagaagctgctaggatcggatattttcacaggggagccttctctgctccctgatagccctgtgggccagcttcatgcctccctactgggcctcagccaactcctgcagcctgagggtcaccactgggagactcagcagattccaagcctcagtcccagccagccatggcagcgtctccttctccgcttcaaaatccttcgcagcctccaggcctttgtggctgtagccgcccgggtctttgcccatggagcagcaaccctgagtccctaa
Sequence Length
570
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
20,730 Da
NCBI Official Full Name
Homo sapiens interleukin 23, alpha subunit p19, mRNA
NCBI Official Synonym Full Names
interleukin 23 subunit alpha
NCBI Official Symbol
IL23A
NCBI Official Synonym Symbols
P19; SGRF; IL-23; IL-23A; IL23P19
NCBI Protein Information
interleukin-23 subunit alpha
UniProt Protein Name
Interleukin-23 subunit alpha
Protein Family
UniProt Gene Name
IL23A
UniProt Synonym Gene Names
SGRF; IL-23 subunit alpha; IL-23-A; IL-23p19
UniProt Entry Name
IL23A_HUMAN

NCBI Description

This gene encodes a subunit of the heterodimeric cytokine interleukin 23 (IL23). IL23 is composed of this protein and the p40 subunit of interleukin 12 (IL12B). The receptor of IL23 is formed by the beta 1 subunit of IL12 (IL12RB1) and an IL23 specific subunit, IL23R. Both IL23 and IL12 can activate the transcription activator STAT4, and stimulate the production of interferon-gamma (IFNG). In contrast to IL12, which acts mainly on naive CD4(+) T cells, IL23 preferentially acts on memory CD4(+) T cells. [provided by RefSeq, Jul 2008]

Uniprot Description

IL23A: Associates with IL12B to form the IL-23 interleukin, a heterodimeric cytokine which functions in innate and adaptive immunity. IL-23 may constitute with IL-17 an acute response to infection in peripheral tissues. IL-23 binds to a heterodimeric receptor complex composed of IL12RB1 and IL23R, activates the Jak- Stat signaling cascade, stimulates memory rather than naive T- cells and promotes production of proinflammatory cytokines. IL-23 induces autoimmune inflammation and thus may be responsible for autoimmune inflammatory diseases and may be important for tumorigenesis. Belongs to the IL-6 superfamily.

Protein type: Cytokine; Secreted, signal peptide; Secreted

Chromosomal Location of Human Ortholog: 12q13.3

Cellular Component: extracellular region

Molecular Function: interleukin-23 receptor binding; protein binding

Biological Process: defense response to Gram-negative bacterium; negative regulation of interleukin-10 production; positive regulation of activated T cell proliferation; positive regulation of defense response to virus by host; positive regulation of granulocyte macrophage colony-stimulating factor production; positive regulation of inflammatory response; positive regulation of interferon-gamma production; positive regulation of interleukin-10 production; positive regulation of interleukin-12 production; positive regulation of interleukin-17 production; positive regulation of memory T cell differentiation; positive regulation of natural killer cell activation; positive regulation of natural killer cell proliferation; positive regulation of NF-kappaB import into nucleus; positive regulation of NK T cell activation; positive regulation of NK T cell proliferation; positive regulation of osteoclast differentiation; positive regulation of T cell mediated cytotoxicity; positive regulation of T cell proliferation; positive regulation of T-helper 1 type immune response; positive regulation of tissue remodeling; positive regulation of tumor necrosis factor production; positive regulation of tyrosine phosphorylation of Stat3 protein; positive regulation of tyrosine phosphorylation of Stat4 protein; positive regulation of tyrosine phosphorylation of Stat5 protein; regulation of tyrosine phosphorylation of Stat1 protein

Research Articles on IL23A

Similar Products

Product Notes

The IL23A il23a (Catalog #AAA1273437) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgggga gcagagctgt aatgctgctg ttgctgctgc cctggacagc tcagggcaga gctgtgcctg ggggcagcag ccctgcctgg actcagtgcc agcagctttc acagaagctc tgcacactgg cctggagtgc acatccacta gtgggacaca tggatctaag agaagaggga gatgaagaga ctacaaatga tgttccccat atccagtgtg gagatggctg tgacccccaa ggactcaggg acaacagtca gttctgcttg caaaggatcc accagggtct gattttttat gagaagctgc taggatcgga tattttcaca ggggagcctt ctctgctccc tgatagccct gtgggccagc ttcatgcctc cctactgggc ctcagccaac tcctgcagcc tgagggtcac cactgggaga ctcagcagat tccaagcctc agtcccagcc agccatggca gcgtctcctt ctccgcttca aaatccttcg cagcctccag gcctttgtgg ctgtagccgc ccgggtcttt gcccatggag cagcaaccct gagtccctaa. It is sometimes possible for the material contained within the vial of "IL23A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.