IL18R1 cdna clone

IL18R1 cDNA Clone

Gene Names

IL18R1; CD218a; IL18RA; IL1RRP; CDw218a; IL-1Rrp

Synonyms

IL18R1; IL18R1 cDNA Clone; IL18R1 cdna clone

Ordering
Cat. Num. AAA1274556 For Research Use Only!

Sequence

atgaattgtagagaattacccttgaccctttgggtgcttatatctgtaagcactgcagaatcttgtacttcacgtccccacattactgtggttgaaggggaacctttctatctgaaacattgctcgtgttcacttgcacatgagattgaaacaaccaccaaaagctggtacaaaagcagtggatcacaggaacatgtggagctgaacccaaggagttcctcgagaattgctttgcatgattgtgttttggagttttggccagttgagttgaatgacacaggatcttactttttccaaatgaaaaattatactcagaaatggaaattaaatgtcatcagaagaaataaacacagctgtttcactgaaagacaagtaactagtaaaattgtggaagttaaaaaattttttcagataacctgtgaaaacagttactatcaaacactggtcaacagcacatcattgtataagaactgtaaaaagctactactggagaacaataaaaacccaacgataaagaagaacgccgagtttgaagatcaggggtattactcctgcgtgcatttccttcatcataatggaaaactatttaatatcaccaaaaccttcaatataacaatagtggaagatcgcagtaatatagttccggttcttcttggaccaaagcttaaccatgttgcagtggaattaggaaaaaacgtaaggctcaactgctctgctttgctgaatgaagaggatgtaatttattggatgttcggggaagaaaatggatcggatcctaatatacatgaagagaaagaaatgagaattatgactccagaaggcaaatggcatgcttcaaaagtattgagaattgaaaatattggtgaaagcaatctaaatgttttatataattgcactgtggccagcacgggaggcacagacaccaaaagcttcatcttggtgagaaaagcagacatggctgatatcccaggccacgtcttcacaagaggaatgatcatagctgttttgatcttggtggcagtagtgtgcctagtgactgtgtgtgtcatttatagagttgacttggttctattttatagacatttaacgagaagagatgaaacattaacagatggaaaaacatatgatgcttttgtgtcttacctaaaagaatgccgacctgaaaatggagaggagcacacctttgctgtggagattttgcccagggtgttggagaaacattttgggtataagttatgcatatttgaaagggatgtagtgcctggaggagctgttgttgatgaaatccactcactgatagagaaaagccgaagactaatcattgtcctaagtaaaagttatatgtctaatgaggtcaggtatgaacttgaaagtggactccatgaagcattggtggaaagaaaaattaaaataatcttaattgaatttacacctgttactgacttcacattcttgccccaatcactaaagcttttgaaatctcacagagttctgaagtggaaggccgataaatctctttcttataactcaaggttctggaagaaccttctttacttaatgcctgcaaaaacagtcaagccaggtagagacgaaccggaagtcttgcctgttctttccgagtcttaa

Sequence Length

1626

Vector

Please Inquire

NCBI and Uniprot Product Information

NCBI GI #

47481175

NCBI GeneID

8809

Molecular Weight

62,304 Da

NCBI Official Full Name

Homo sapiens interleukin 18 receptor 1, mRNA

NCBI Official Synonym Full Names

interleukin 18 receptor 1

NCBI Official Symbol

IL18R1

NCBI Official Synonym Symbols

CD218a; IL18RA; IL1RRP; CDw218a; IL-1Rrp

NCBI Protein Information

interleukin-18 receptor 1

UniProt Protein Name

Interleukin-18 receptor 1

Protein Family

Interleukin-18 receptor

UniProt Gene Name

IL18R1

UniProt Synonym Gene Names

IL1RRP; IL-18R-1; IL-18R1; IL-1Rrp; IL1R-rp

UniProt Entry Name

IL18R_HUMAN

NCBI Description

The protein encoded by this gene is a cytokine receptor that belongs to the interleukin 1 receptor family. This receptor specifically binds interleukin 18 (IL18), and is essential for IL18 mediated signal transduction. IFN-alpha and IL12 are reported to induce the expression of this receptor in NK and T cells. This gene along with four other members of the interleukin 1 receptor family, including IL1R2, IL1R1, ILRL2 (IL-1Rrp2), and IL1RL1 (T1/ST2), form a gene cluster on chromosome 2q. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]

Uniprot Description

IL18R1: Receptor for interleukin 18 (IL-18). Binding to the agonist leads to the activation of NF-kappa-B. Belongs to the interleukin-1 receptor family.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 2q12

Cellular Component: plasma membrane

Molecular Function: protein binding; receptor activity

Biological Process: immune response; signal transduction

Research Articles on IL18R1

1. strong evidence that IL-18 and IL18Ralpha have important functions in the pathogenesis of allergic asthma

Similar Products

Product Notes

The IL18R1 il18r1 (Catalog #AAA1274556) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaattgta gagaattacc cttgaccctt tgggtgctta tatctgtaag cactgcagaa tcttgtactt cacgtcccca cattactgtg gttgaagggg aacctttcta tctgaaacat tgctcgtgtt cacttgcaca tgagattgaa acaaccacca aaagctggta caaaagcagt ggatcacagg aacatgtgga gctgaaccca aggagttcct cgagaattgc tttgcatgat tgtgttttgg agttttggcc agttgagttg aatgacacag gatcttactt tttccaaatg aaaaattata ctcagaaatg gaaattaaat gtcatcagaa gaaataaaca cagctgtttc actgaaagac aagtaactag taaaattgtg gaagttaaaa aattttttca gataacctgt gaaaacagtt actatcaaac actggtcaac agcacatcat tgtataagaa ctgtaaaaag ctactactgg agaacaataa aaacccaacg ataaagaaga acgccgagtt tgaagatcag gggtattact cctgcgtgca tttccttcat cataatggaa aactatttaa tatcaccaaa accttcaata taacaatagt ggaagatcgc agtaatatag ttccggttct tcttggacca aagcttaacc atgttgcagt ggaattagga aaaaacgtaa ggctcaactg ctctgctttg ctgaatgaag aggatgtaat ttattggatg ttcggggaag aaaatggatc ggatcctaat atacatgaag agaaagaaat gagaattatg actccagaag gcaaatggca tgcttcaaaa gtattgagaa ttgaaaatat tggtgaaagc aatctaaatg ttttatataa ttgcactgtg gccagcacgg gaggcacaga caccaaaagc ttcatcttgg tgagaaaagc agacatggct gatatcccag gccacgtctt cacaagagga atgatcatag ctgttttgat cttggtggca gtagtgtgcc tagtgactgt gtgtgtcatt tatagagttg acttggttct attttataga catttaacga gaagagatga aacattaaca gatggaaaaa catatgatgc ttttgtgtct tacctaaaag aatgccgacc tgaaaatgga gaggagcaca cctttgctgt ggagattttg cccagggtgt tggagaaaca ttttgggtat aagttatgca tatttgaaag ggatgtagtg cctggaggag ctgttgttga tgaaatccac tcactgatag agaaaagccg aagactaatc attgtcctaa gtaaaagtta tatgtctaat gaggtcaggt atgaacttga aagtggactc catgaagcat tggtggaaag aaaaattaaa ataatcttaa ttgaatttac acctgttact gacttcacat tcttgcccca atcactaaag cttttgaaat ctcacagagt tctgaagtgg aaggccgata aatctctttc ttataactca aggttctgga agaaccttct ttacttaatg cctgcaaaaa cagtcaagcc aggtagagac gaaccggaag tcttgcctgt tctttccgag tcttaa. It is sometimes possible for the material contained within the vial of "IL18R1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Loading...

IL18R1 cdna clone