Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HSD17B4 cdna clone

HSD17B4 cDNA Clone

Gene Names
HSD17B4; DBP; MFE-2; MPF-2; PRLTS1; SDR8C1
Synonyms
HSD17B4; HSD17B4 cDNA Clone; HSD17B4 cdna clone
Ordering
For Research Use Only!
Sequence
atgggctcaccgctgaggttcgacgggcgggtggtactggtcaccggcgcgggggcaggattgggccgagcctatgccctggcttttgcagaaagaggagcgttagttgttgtgaatgatttgggaggggacttcaaaggagttggtaaaggctccttagctgctgataaggttgttgaagaaataagaaggagaggtggaaaagcagtggccaactatgattcagtggaagaaggagagaaggttgtgaagacagccctggatgcttttggaagaatagatgttgtggtcaacaatgctggaattctgagggatcgttcctttgctaggataagtgatgaagactgggatataatccacagagttcatttgcggggttcattccaagtgacacgggcagcatgggaacacatgaagaaacagaagtatggaaggattattatgacttcatcagcttcaggaatatatggcaactttggccaggccaattatagtgctgcaaagttgggtcttctgggccttgcaaattctcttgcaattgaaggcaggaaaagcaacattcattgtaacaccattgctcctaatgcgggatcacggatgactcagacagttatgcctgaagatcttgtggaagccctgaagccagagtatgtggcacctcttgtcctttggctttgtcacgagagttgtgaggagaatggtggcttgtttgaggttggagcaggatggattggaaaattacgctgggagcggactcttggagctattgtaagacaaaagaatcacccaatgactcctgaggcagtcaaggctaactggaagaagatctgtgactttgagaatgccagcaagcctcagagtatccaagaatcaactggcagtataattgaagttctgagtaaaatagattcagaaggaggagtttcagcaaatcatactagtcgtgcaacgtctacagcaacatcaggatttgctggagctattggccagaaactccctccattttcttatgcttatacggaactggaagctattatgtatgcccttggagtgggagcgtcaatcaaggatccaaaagatttgaaatttatttatgaaggaagttctgatttctcctgtttgcccaccttcggagttatcataggtcagaaatctatgatgggtggaggattagcagaaattcctggactttcaatcaactttgcaaaggttcttcatggagagcagtacttagagttatataaaccacttcccagagcaggaaaattaaaatgtgaagcagttgttgctgatgtcctagataaaggatccggtgtagtgattattatggatgtctattcttattctgagaaggaacttatatgccacaatcagttctctctctttcttgttggctctggaggctttggtggaaaacggacatcagacaaagtcaaggtagctgtagccatacctaatagacctcctgatgctgtacttacagataccacctctcttaatcaggctgctttgtaccgcctcagtggagactggaatcccttacacattgatcctaactttgctagtctagcaggttttgacaagcccatattacatggattatgtacatttggattttctgccaggcgtgtgttacagcagtttgcagataatgatgtgtcaagattcaaggcaattaaggctcgttttgcaaaaccagtatatccaggacaaactctacaaactgagatgtggaaggaaggaaacagaattcattttcaaaccaaggtccaagaaactggagacattgtcatttcaaatgcatatgtggatcttgcaccaacatctggtacttcagctaagacaccctctgagggcgggaagcttcagagtacctttgtatttgaggaaataggacgccgcctaaaggatattgggcctgaggtggtgaagaaagtaaatgctgtatttgagtggcatataaccaaaggcggaaatattggggctaagtggactattgacctgaaaagtggttctggaaaagtgtaccaaggccctgcaaaaggtgctgctgatacaacaatcatactttcagatgaagatttcatggaggtggtcctgggcaagcttgaccctcagaaggcattctttagtggcaggctgaaggccagagggaacatcatgctgagccagaaacttcagatgattcttaaagactacgccaagctctga
Sequence Length
2211
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
77,870 Da
NCBI Official Full Name
Homo sapiens hydroxysteroid (17-beta) dehydrogenase 4, mRNA
NCBI Official Synonym Full Names
hydroxysteroid 17-beta dehydrogenase 4
NCBI Official Symbol
HSD17B4
NCBI Official Synonym Symbols
DBP; MFE-2; MPF-2; PRLTS1; SDR8C1
NCBI Protein Information
peroxisomal multifunctional enzyme type 2
UniProt Protein Name
Peroxisomal multifunctional enzyme type 2
UniProt Gene Name
HSD17B4
UniProt Synonym Gene Names
EDH17B4; SDR8C1; MFE-2; 17-beta-HSD 4; DBP; MPF-2
UniProt Entry Name
DHB4_HUMAN

NCBI Description

The protein encoded by this gene is a bifunctional enzyme that is involved in the peroxisomal beta-oxidation pathway for fatty acids. It also acts as a catalyst for the formation of 3-ketoacyl-CoA intermediates from both straight-chain and 2-methyl-branched-chain fatty acids. Defects in this gene that affect the peroxisomal fatty acid beta-oxidation activity are a cause of D-bifunctional protein deficiency (DBPD). An apparent pseudogene of this gene is present on chromosome 8. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2014]

Uniprot Description

HSD17B4: Bifunctional enzyme acting on the peroxisomal beta- oxidation pathway for fatty acids. Catalyzes the formation of 3- ketoacyl-CoA intermediates from both straight-chain and 2-methyl- branched-chain fatty acids. Defects in HSD17B4 are a cause of D-bifunctional protein deficiency (DBPD). DBPD is a disorder of peroxisomal fatty acid beta-oxidation. Defects in HSD17B4 are the cause of Perrault syndrome (PRS). PRS is a sex-influenced disorder characterized by sensorineural deafness in both males and females and ovarian dysgenesis in females. Some patients also have neurologic manifestations, including mild mental retardation and cerebellar and peripheral nervous system involvement. Belongs to the short-chain dehydrogenases/reductases (SDR) family.

Protein type: Oxidoreductase; Mitochondrial; EC 4.2.1.119; Cell development/differentiation; Lyase; EC 1.1.1.n12; EC 4.2.1.107; Lipid Metabolism - primary bile acid biosynthesis

Chromosomal Location of Human Ortholog: 5q21

Cellular Component: intracellular membrane-bound organelle; membrane; peroxisomal matrix; peroxisomal membrane; peroxisome

Molecular Function: 3-hydroxyacyl-CoA dehydrogenase activity; 3alpha,7alpha,12alpha-trihydroxy-5beta-cholest-24-enoyl-CoA hydratase activity; long-chain-enoyl-CoA hydratase activity; protein homodimerization activity; receptor binding

Biological Process: androgen metabolic process; bile acid biosynthetic process; estrogen metabolic process; fatty acid beta-oxidation; fatty acid beta-oxidation using acyl-CoA oxidase; osteoblast differentiation

Disease: D-bifunctional Protein Deficiency; Perrault Syndrome 1

Research Articles on HSD17B4

Similar Products

Product Notes

The HSD17B4 hsd17b4 (Catalog #AAA1270190) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggctcac cgctgaggtt cgacgggcgg gtggtactgg tcaccggcgc gggggcagga ttgggccgag cctatgccct ggcttttgca gaaagaggag cgttagttgt tgtgaatgat ttgggagggg acttcaaagg agttggtaaa ggctccttag ctgctgataa ggttgttgaa gaaataagaa ggagaggtgg aaaagcagtg gccaactatg attcagtgga agaaggagag aaggttgtga agacagccct ggatgctttt ggaagaatag atgttgtggt caacaatgct ggaattctga gggatcgttc ctttgctagg ataagtgatg aagactggga tataatccac agagttcatt tgcggggttc attccaagtg acacgggcag catgggaaca catgaagaaa cagaagtatg gaaggattat tatgacttca tcagcttcag gaatatatgg caactttggc caggccaatt atagtgctgc aaagttgggt cttctgggcc ttgcaaattc tcttgcaatt gaaggcagga aaagcaacat tcattgtaac accattgctc ctaatgcggg atcacggatg actcagacag ttatgcctga agatcttgtg gaagccctga agccagagta tgtggcacct cttgtccttt ggctttgtca cgagagttgt gaggagaatg gtggcttgtt tgaggttgga gcaggatgga ttggaaaatt acgctgggag cggactcttg gagctattgt aagacaaaag aatcacccaa tgactcctga ggcagtcaag gctaactgga agaagatctg tgactttgag aatgccagca agcctcagag tatccaagaa tcaactggca gtataattga agttctgagt aaaatagatt cagaaggagg agtttcagca aatcatacta gtcgtgcaac gtctacagca acatcaggat ttgctggagc tattggccag aaactccctc cattttctta tgcttatacg gaactggaag ctattatgta tgcccttgga gtgggagcgt caatcaagga tccaaaagat ttgaaattta tttatgaagg aagttctgat ttctcctgtt tgcccacctt cggagttatc ataggtcaga aatctatgat gggtggagga ttagcagaaa ttcctggact ttcaatcaac tttgcaaagg ttcttcatgg agagcagtac ttagagttat ataaaccact tcccagagca ggaaaattaa aatgtgaagc agttgttgct gatgtcctag ataaaggatc cggtgtagtg attattatgg atgtctattc ttattctgag aaggaactta tatgccacaa tcagttctct ctctttcttg ttggctctgg aggctttggt ggaaaacgga catcagacaa agtcaaggta gctgtagcca tacctaatag acctcctgat gctgtactta cagataccac ctctcttaat caggctgctt tgtaccgcct cagtggagac tggaatccct tacacattga tcctaacttt gctagtctag caggttttga caagcccata ttacatggat tatgtacatt tggattttct gccaggcgtg tgttacagca gtttgcagat aatgatgtgt caagattcaa ggcaattaag gctcgttttg caaaaccagt atatccagga caaactctac aaactgagat gtggaaggaa ggaaacagaa ttcattttca aaccaaggtc caagaaactg gagacattgt catttcaaat gcatatgtgg atcttgcacc aacatctggt acttcagcta agacaccctc tgagggcggg aagcttcaga gtacctttgt atttgaggaa ataggacgcc gcctaaagga tattgggcct gaggtggtga agaaagtaaa tgctgtattt gagtggcata taaccaaagg cggaaatatt ggggctaagt ggactattga cctgaaaagt ggttctggaa aagtgtacca aggccctgca aaaggtgctg ctgatacaac aatcatactt tcagatgaag atttcatgga ggtggtcctg ggcaagcttg accctcagaa ggcattcttt agtggcaggc tgaaggccag agggaacatc atgctgagcc agaaacttca gatgattctt aaagactacg ccaagctctg a. It is sometimes possible for the material contained within the vial of "HSD17B4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.