Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HLA-E cdna clone

HLA-E cDNA Clone

Gene Names
HLA-E; QA1; HLA-6.2
Synonyms
HLA-E; HLA-E cDNA Clone; HLA-E cdna clone
Ordering
For Research Use Only!
Sequence
atggtagatggaaccctccttttactcctctcggaggccctggcccttacccagacctgggcgggctcccactccttgaagtatttccacacttccgtgtcccggcccggccgcggggagccccgcttcatctctgtgggctacgtggacgacacccagttcgtgcgcttcgacaacgacgccgcgagtccgaggatggtgccgcgggcgccgtggatggagcaggaggggtcagagtattgggaccgggagacacggagcgccagggacaccgcacagattttccgagtgaacctgcggacgctgcgcggctactacaatcagagcgaggccgggtctcacaccctgcagtggatgcatggctgcgagctggggcccgacaggcgcttcctccgcgggtatgaacagttcgcctacgacggcaaggattatctcaccctgaatgaggacctgcgctcctggaccgcggtggacacggcggctcagatctccgagcaaaagtcaaatgatgcctctgaggcggagcaccagagagcctacctggaagacacatgcgtggagtggctccacaaatacctggagaaggggaaggagacgctgcttcacctggagcccccaaagacacacgtgactcaccaccccatctctgaccatgaggccaccctgaggtgctgggccctgggcttctaccctgcggagatcacactgacctggcagcaggatggggagggccatacccaggacacggagctcgtggagaccaggcctgcaggggatggaaccttccagaagtgggcagctgtggtggtgccttctggagaggagcagagatacacgtgccatgtgcagcatgaggggctacccgagcccgtcaccctgagatggaagccggcttcccagcccaccatccccatcgtgggcatcattgctggcctggttctccttggatctgtggtctctggagctgtggttgctgctgtgatatggaggaagaagagctcaggtggaaaaggagggagctactctaaggctgagtggagcgacagtgcccaggggtctgagtctcacagcttgtaa
Sequence Length
1077
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
40,157 Da
NCBI Official Full Name
Homo sapiens major histocompatibility complex, class I, E, mRNA
NCBI Official Synonym Full Names
major histocompatibility complex, class I, E
NCBI Official Symbol
HLA-E
NCBI Official Synonym Symbols
QA1; HLA-6.2
NCBI Protein Information
HLA class I histocompatibility antigen, alpha chain E
UniProt Protein Name
HLA class I histocompatibility antigen, alpha chain E
UniProt Gene Name
HLA-E
UniProt Synonym Gene Names
HLA-6.2; HLAE
UniProt Entry Name
HLAE_HUMAN

NCBI Description

HLA-E belongs to the HLA class I heavy chain paralogues. This class I molecule is a heterodimer consisting of a heavy chain and a light chain (beta-2 microglobulin). The heavy chain is anchored in the membrane. HLA-E binds a restricted subset of peptides derived from the leader peptides of other class I molecules. The heavy chain is approximately 45 kDa and its gene contains 8 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the alpha1 and alpha2 domains, which both bind the peptide, exon 4 encodes the alpha3 domain, exon 5 encodes the transmembrane region, and exons 6 and 7 encode the cytoplasmic tail. [provided by RefSeq, Jul 2008]

Uniprot Description

HLA-E: Preferably binds to a peptide derived from the signal sequence of most HLA-A, -B, -C and -G molecules. Belongs to the MHC class I family.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 6p21.3

Cellular Component: cell surface; early endosome membrane; Golgi membrane; MHC class I protein complex; phagocytic vesicle membrane; plasma membrane

Molecular Function: beta-2-microglobulin binding; MHC class I protein binding; natural killer cell lectin-like receptor binding; peptide antigen binding; receptor binding

Biological Process: adaptive immune response; antibacterial humoral response; antigen processing and presentation of endogenous peptide antigen via MHC class Ib; antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent; antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent; antigen processing and presentation of peptide antigen via MHC class I; defense response to Gram-positive bacterium; innate immune response; positive regulation of immunoglobulin secretion; positive regulation of interleukin-13 production; positive regulation of interleukin-4 production; positive regulation of natural killer cell mediated immunity; positive regulation of T cell mediated cytotoxicity; positive regulation of TRAIL production; positive regulation of tumor necrosis factor production; protection from natural killer cell mediated cytotoxicity; regulation of immune response; regulation of natural killer cell mediated immunity

Research Articles on HLA-E

Similar Products

Product Notes

The HLA-E hla-e (Catalog #AAA1274543) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtagatg gaaccctcct tttactcctc tcggaggccc tggcccttac ccagacctgg gcgggctccc actccttgaa gtatttccac acttccgtgt cccggcccgg ccgcggggag ccccgcttca tctctgtggg ctacgtggac gacacccagt tcgtgcgctt cgacaacgac gccgcgagtc cgaggatggt gccgcgggcg ccgtggatgg agcaggaggg gtcagagtat tgggaccggg agacacggag cgccagggac accgcacaga ttttccgagt gaacctgcgg acgctgcgcg gctactacaa tcagagcgag gccgggtctc acaccctgca gtggatgcat ggctgcgagc tggggcccga caggcgcttc ctccgcgggt atgaacagtt cgcctacgac ggcaaggatt atctcaccct gaatgaggac ctgcgctcct ggaccgcggt ggacacggcg gctcagatct ccgagcaaaa gtcaaatgat gcctctgagg cggagcacca gagagcctac ctggaagaca catgcgtgga gtggctccac aaatacctgg agaaggggaa ggagacgctg cttcacctgg agcccccaaa gacacacgtg actcaccacc ccatctctga ccatgaggcc accctgaggt gctgggccct gggcttctac cctgcggaga tcacactgac ctggcagcag gatggggagg gccataccca ggacacggag ctcgtggaga ccaggcctgc aggggatgga accttccaga agtgggcagc tgtggtggtg ccttctggag aggagcagag atacacgtgc catgtgcagc atgaggggct acccgagccc gtcaccctga gatggaagcc ggcttcccag cccaccatcc ccatcgtggg catcattgct ggcctggttc tccttggatc tgtggtctct ggagctgtgg ttgctgctgt gatatggagg aagaagagct caggtggaaa aggagggagc tactctaagg ctgagtggag cgacagtgcc caggggtctg agtctcacag cttgtaa. It is sometimes possible for the material contained within the vial of "HLA-E, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.