Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HK3 cdna clone

HK3 cDNA Clone

Gene Names
HK3; HXK3; HKIII
Synonyms
HK3; HK3 cDNA Clone; HK3 cdna clone
Ordering
For Research Use Only!
Sequence
atggactccattgggtcttcagggttgcggcagggggaagaaaccctgagttgctctgaggagggcttgcccgggccctcagacagctcagagctggtgcaggagtgcctgcagcagttcaaggtgacaagggcacagctacagcagatccaagccagcctcttgggttccatggagcaggcgctgaggggacaggccagccctgcccctgcggtccggatgctgcctacatacgtggggtccaccccacatggcactgagcaaggagacttcgtggtgctggagctgggggccacaggggcctcactgcgtgttttgtgggtgactctaactggcattgaggggcatagggtggagcccagaagccaggagtttgtgatcccccaagaggtgatgctgggtgctggccagcagctctttgactttgctgcccactgcctgtctgagttcctggatgcgcagcctgtgaacaaacagggtctgcagcttggcttcagcttctctttcccttgtcaccagacgggcttggacaggagcaccctcatttcctggaccaaaggttttaggtgcagtggtgtggaaggccaggatgtggtccagctgctgagagatgccattcggaggcagggggcctacaacatcgacgtggttgctgtggtgaacgacacagtgggcaccatgatgggctgtgagccgggggtcaggccgtgtgaggttgggctagttgtagacacgggcaccaacgcgtgttacatggaggaggcacggcatgtggcagtgctggacgaagaccggggccgcgtctgcgtcagcgtcgagtggggctccttcagcgatgatggggcgctgggaccagtgctgaccaccttcgaccataccctggaccatgagtccctgaatcctggtgctcagaggtttgagaagatgatcggaggcctgtacctgggtgagctggtgcggctggtgctggctcacttggcccggtgtggggtcctctttggtggctgcacctcccctgccctgctgagccaaggcagcatcctcctggaacacgtggctgagatggaggacccctctactggggcagcccgtgtccatgctatcctgcaggacttgggcctgagccctggggcttcggatgttgagcttgtgcagcacgtctgtgcggccgtgtgcacgcgggctgcccagctctgtgctgccgccctggccgctgttctctcctgcctccagcacagccgggagcaacaaacactccaggttgctgtggccaccggaggccgagtgtgtgagcggcaccccaggttctgcagcgtcctgcaggggacagtgatgctcctggccccggaatgcgatgtctccttaatcccctctgtggatggtggtggccggggagtggcgatggtgactgctgtggctgcccgtctggctgcccaccggcgcctgctggaggagaccctggccccattccggttgaaccatgatcaactggctgcggttcaggcacagatgcggaaggccatggccaaggggctccgaggggaggcctcctcccttcgcatgctgcccactttcgtccgggccacccctgatggcagcgagcgaggggatttcctggccctggacctcgggggcacgaacttccgtgtcctcctggtacgtgtgaccacaggcgtgcagatcaccagcgagatctactccattcccgagactgtggcccagggttctgggcagcagctctttgaccacatcgtggactgcatcgtggacttccagcagaagcagggcctgagcgggcagagcctcccactgggttttaccttctccttcccatgtaggcagcttggcctagaccagggcatcctcctgaactggaccaagggtttcaaggcatcagactgcgagggccaagatgtcgtgagtctgttgcgggaagccatcactcgcagacaggcagtggagctgaatgtggttgccattgtcaatgacacggtggggaccatgatgtcctgtggctatgaggacccccgttgcgagataggcctcattgtcggaaccggcaccaatgcctgctacatggaggagctccggaatgtggcgggcgtgcctggggactcaggccgcatgtgcatcaacatggagtggggcgcctttggggacgatggctctctggccatgctcagcacccgctttgatgcaagtgtggaccaggcgtccatcaaccccggcaagcagaggtttgaaaagatgatcagcggcatgtacctgggggagatcgtccgccacatccttttacatttaaccagccttggcgttctcttccggggccagcagatccagcgccttcagaccagggacatcttcaagaccaagttcctctctgagatcgaaagtgacagcctggccctgcggcaggtccgagccatcctagaggatctggggctacccctgacctcagatgacgccctgatggtgctagaggtgtgccaggctgtgtcccagagggctgcccagctctgtggggcgggtgtagctgccgtggtggagaagatccgggagaaccggggcctggaagagctggcagtgtctgtgggggtggatggaacgctctacaagctgcacccgcgcttctccagcctggtggcggccacagtgcgggagctggcccctcgctgtgtggtcacgttcctgcagtcagaggatgggtccggcaaaggtgcggccctggtcaccgctgttgcctgccgccttgcgcagttgactcgtgtctga
Sequence Length
2772
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
99,025 Da
NCBI Official Full Name
Homo sapiens hexokinase 3 (white cell), mRNA
NCBI Official Synonym Full Names
hexokinase 3
NCBI Official Symbol
HK3
NCBI Official Synonym Symbols
HXK3; HKIII
NCBI Protein Information
hexokinase-3
UniProt Protein Name
Hexokinase-3
Protein Family
UniProt Gene Name
HK3
UniProt Synonym Gene Names
HK III
UniProt Entry Name
HXK3_HUMAN

NCBI Description

Hexokinases phosphorylate glucose to produce glucose-6-phosphate, the first step in most glucose metabolism pathways. This gene encodes hexokinase 3. Similar to hexokinases 1 and 2, this allosteric enzyme is inhibited by its product glucose-6-phosphate. [provided by RefSeq, Apr 2009]

Uniprot Description

HK3: a glycolytic enzyme that catalyzes the reaction ATP + D-hexose = ADP + D-hexose 6-phosphate. The first and rate-limiting step in glycosis, a pathway that produces energy in the form of ATP from glucose. An allosteric enzyme inhibited by its product glucose-6-phosphate (Glc-6-P). Acts as a ""glucose sensor"" by trapping glucose inside the cell by catalyzing its phosphorylation to produce Glc-6-P. In vertebrates there are four major glucose-phosphorylating isoenzymes, designated hexokinase I, II, III and IV (glucokinase).

Protein type: Enzyme, cellular metabolism; Kinase, other; Carbohydrate Metabolism - fructose and mannose; Carbohydrate Metabolism - amino sugar and nucleotide sugar; Carbohydrate Metabolism - starch and sucrose; Carbohydrate Metabolism - glycolysis and gluconeogenesis; EC 2.7.1.1; Transferase; Carbohydrate Metabolism - galactose

Chromosomal Location of Human Ortholog: 5q35.2

Cellular Component: cytosol

Molecular Function: fructokinase activity; glucokinase activity; hexokinase activity; mannokinase activity

Biological Process: cell glucose homeostasis; glucose transport; glycolysis

Research Articles on HK3

Similar Products

Product Notes

The HK3 hk3 (Catalog #AAA1266848) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggactcca ttgggtcttc agggttgcgg cagggggaag aaaccctgag ttgctctgag gagggcttgc ccgggccctc agacagctca gagctggtgc aggagtgcct gcagcagttc aaggtgacaa gggcacagct acagcagatc caagccagcc tcttgggttc catggagcag gcgctgaggg gacaggccag ccctgcccct gcggtccgga tgctgcctac atacgtgggg tccaccccac atggcactga gcaaggagac ttcgtggtgc tggagctggg ggccacaggg gcctcactgc gtgttttgtg ggtgactcta actggcattg aggggcatag ggtggagccc agaagccagg agtttgtgat cccccaagag gtgatgctgg gtgctggcca gcagctcttt gactttgctg cccactgcct gtctgagttc ctggatgcgc agcctgtgaa caaacagggt ctgcagcttg gcttcagctt ctctttccct tgtcaccaga cgggcttgga caggagcacc ctcatttcct ggaccaaagg ttttaggtgc agtggtgtgg aaggccagga tgtggtccag ctgctgagag atgccattcg gaggcagggg gcctacaaca tcgacgtggt tgctgtggtg aacgacacag tgggcaccat gatgggctgt gagccggggg tcaggccgtg tgaggttggg ctagttgtag acacgggcac caacgcgtgt tacatggagg aggcacggca tgtggcagtg ctggacgaag accggggccg cgtctgcgtc agcgtcgagt ggggctcctt cagcgatgat ggggcgctgg gaccagtgct gaccaccttc gaccataccc tggaccatga gtccctgaat cctggtgctc agaggtttga gaagatgatc ggaggcctgt acctgggtga gctggtgcgg ctggtgctgg ctcacttggc ccggtgtggg gtcctctttg gtggctgcac ctcccctgcc ctgctgagcc aaggcagcat cctcctggaa cacgtggctg agatggagga cccctctact ggggcagccc gtgtccatgc tatcctgcag gacttgggcc tgagccctgg ggcttcggat gttgagcttg tgcagcacgt ctgtgcggcc gtgtgcacgc gggctgccca gctctgtgct gccgccctgg ccgctgttct ctcctgcctc cagcacagcc gggagcaaca aacactccag gttgctgtgg ccaccggagg ccgagtgtgt gagcggcacc ccaggttctg cagcgtcctg caggggacag tgatgctcct ggccccggaa tgcgatgtct ccttaatccc ctctgtggat ggtggtggcc ggggagtggc gatggtgact gctgtggctg cccgtctggc tgcccaccgg cgcctgctgg aggagaccct ggccccattc cggttgaacc atgatcaact ggctgcggtt caggcacaga tgcggaaggc catggccaag gggctccgag gggaggcctc ctcccttcgc atgctgccca ctttcgtccg ggccacccct gatggcagcg agcgagggga tttcctggcc ctggacctcg ggggcacgaa cttccgtgtc ctcctggtac gtgtgaccac aggcgtgcag atcaccagcg agatctactc cattcccgag actgtggccc agggttctgg gcagcagctc tttgaccaca tcgtggactg catcgtggac ttccagcaga agcagggcct gagcgggcag agcctcccac tgggttttac cttctccttc ccatgtaggc agcttggcct agaccagggc atcctcctga actggaccaa gggtttcaag gcatcagact gcgagggcca agatgtcgtg agtctgttgc gggaagccat cactcgcaga caggcagtgg agctgaatgt ggttgccatt gtcaatgaca cggtggggac catgatgtcc tgtggctatg aggacccccg ttgcgagata ggcctcattg tcggaaccgg caccaatgcc tgctacatgg aggagctccg gaatgtggcg ggcgtgcctg gggactcagg ccgcatgtgc atcaacatgg agtggggcgc ctttggggac gatggctctc tggccatgct cagcacccgc tttgatgcaa gtgtggacca ggcgtccatc aaccccggca agcagaggtt tgaaaagatg atcagcggca tgtacctggg ggagatcgtc cgccacatcc ttttacattt aaccagcctt ggcgttctct tccggggcca gcagatccag cgccttcaga ccagggacat cttcaagacc aagttcctct ctgagatcga aagtgacagc ctggccctgc ggcaggtccg agccatccta gaggatctgg ggctacccct gacctcagat gacgccctga tggtgctaga ggtgtgccag gctgtgtccc agagggctgc ccagctctgt ggggcgggtg tagctgccgt ggtggagaag atccgggaga accggggcct ggaagagctg gcagtgtctg tgggggtgga tggaacgctc tacaagctgc acccgcgctt ctccagcctg gtggcggcca cagtgcggga gctggcccct cgctgtgtgg tcacgttcct gcagtcagag gatgggtccg gcaaaggtgc ggccctggtc accgctgttg cctgccgcct tgcgcagttg actcgtgtct ga. It is sometimes possible for the material contained within the vial of "HK3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.