Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HIF1AN cdna clone

HIF1AN cDNA Clone

Gene Names
HIF1AN; FIH1
Synonyms
HIF1AN; HIF1AN cDNA Clone; HIF1AN cdna clone
Ordering
For Research Use Only!
Sequence
atggcggcgacagcggcggaggctgtggcctctggctctggagagccccgggaggaggctggagccctcggccccgcctgggatgaatcccagttgcgcagttatagcttcccgactaggcccattccgcgtctgagtcagagcgacccccgggcagaggagcttattgagaatgaggagcctgtggtgctgaccgacacaaatcttgtgtatcctgccctgaaatgggaccttgaatacctgcaagagaatattggcaatggagacttctctgtgtacagtgccagcacccacaagttcttgtactatgatgagaagaagatggccaatttccagaactttaagccgaggtccaacagggaagaaatgaaatttcatgagttcgttgagaaactgcaggatatacagcagcgaggaggggaagagaggttgtatctgcagcaaacgctcaatgacactgtgggcaggaagattgtcatggacttcttaggttttaactggaactggattaataagcaacagggaaagcgtggctgggggcagcttacctctaacctgctgctcattggcatggaaggaaatgtgacacctgctcactatgatgagcagcagaacttttttgctcagataaaaggttacaaacgatgcatcttattccctccggatcagttcgagtgcctctacccataccctgttcatcacccatgtgacagacagagccaggtggactttgacaatcccgactacgagaggttccctaatttccaaaatgtggttggttacgaaacagtggttggccctggtgatgttctttacatcccaatgtactggtggcatcacatagagtcattactaaatggggggattaccatcactgtgaacttctggtataagggggctcccacccctaagagaattgaatatcctctcaaagctcatcagaaagtggccataatgagaaacattgagaagatgcttggagaggccttggggaacccacaagaggtggggcccttgttgaacacaatgatcaagggccgatacaactag
Sequence Length
1050
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
40,285 Da
NCBI Official Full Name
Homo sapiens hypoxia inducible factor 1, alpha subunit inhibitor, mRNA
NCBI Official Synonym Full Names
hypoxia inducible factor 1 alpha subunit inhibitor
NCBI Official Symbol
HIF1AN
NCBI Official Synonym Symbols
FIH1
NCBI Protein Information
hypoxia-inducible factor 1-alpha inhibitor
UniProt Protein Name
Hypoxia-inducible factor 1-alpha inhibitor
UniProt Gene Name
HIF1AN
UniProt Synonym Gene Names
FIH1; FIH-1
UniProt Entry Name
HIF1N_HUMAN

Uniprot Description

HIF1AN: Hydroxylates HIF-1 alpha at 'Asp-803' in the C-terminal transactivation domain (CAD). Functions as an oxygen sensor and, under normoxic conditions, the hydroxylation prevents interaction of HIF-1 with transcriptional coactivators including Cbp/p300- interacting transactivator. Involved in transcriptional repression through interaction with HIF1A, VHL and histone deacetylases. Hydroxylates specific Asn residues within ankyrin repeat domains (ARD) of NFKB1, NFKBIA, NOTCH1, ASB4, PPP1R12A and several other ARD-containing proteins. Also hydroxylates Asp and His residues within ARDs of ANK1 and TNKS2, respectively. Negatively regulates NOTCH1 activity, accelerating myogenic differentiation. Positively regulates ASB4 activity, promoting vascular differentiation. Homodimer; homodimerization is essential for catalytic activity. Interacts with VHL and HIF1A. Part of a complex with VHL, HIF1A and HDAC1 or HDAC2 or HDAC3. Interacts with NFKB1 and NFKBIA. Interacts with NOTCH1, NOTCH2 and NOTCH3 but not with NOTCH4. Interacts with APBA3; binding inhibits HIF1AN binding to HIF1A. Interacts with TNKS2. Interacts with PPP1R12A. Interacts with ASB4.

Protein type: EC 1.14.11.30; EC 1.14.11.n4; Oxidoreductase

Chromosomal Location of Human Ortholog: 10q24

Cellular Component: cytoplasm; cytosol; nucleoplasm; nucleus; perinuclear region of cytoplasm

Molecular Function: carboxylic acid binding; cofactor binding; iron ion binding; NF-kappaB binding; Notch binding; oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors; protein binding; protein homodimerization activity; zinc ion binding

Biological Process: negative regulation of Notch signaling pathway; peptidyl-asparagine hydroxylation; peptidyl-aspartic acid hydroxylation; positive regulation of myoblast differentiation

Research Articles on HIF1AN

Similar Products

Product Notes

The HIF1AN hif1an (Catalog #AAA1267004) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcga cagcggcgga ggctgtggcc tctggctctg gagagccccg ggaggaggct ggagccctcg gccccgcctg ggatgaatcc cagttgcgca gttatagctt cccgactagg cccattccgc gtctgagtca gagcgacccc cgggcagagg agcttattga gaatgaggag cctgtggtgc tgaccgacac aaatcttgtg tatcctgccc tgaaatggga ccttgaatac ctgcaagaga atattggcaa tggagacttc tctgtgtaca gtgccagcac ccacaagttc ttgtactatg atgagaagaa gatggccaat ttccagaact ttaagccgag gtccaacagg gaagaaatga aatttcatga gttcgttgag aaactgcagg atatacagca gcgaggaggg gaagagaggt tgtatctgca gcaaacgctc aatgacactg tgggcaggaa gattgtcatg gacttcttag gttttaactg gaactggatt aataagcaac agggaaagcg tggctggggg cagcttacct ctaacctgct gctcattggc atggaaggaa atgtgacacc tgctcactat gatgagcagc agaacttttt tgctcagata aaaggttaca aacgatgcat cttattccct ccggatcagt tcgagtgcct ctacccatac cctgttcatc acccatgtga cagacagagc caggtggact ttgacaatcc cgactacgag aggttcccta atttccaaaa tgtggttggt tacgaaacag tggttggccc tggtgatgtt ctttacatcc caatgtactg gtggcatcac atagagtcat tactaaatgg ggggattacc atcactgtga acttctggta taagggggct cccaccccta agagaattga atatcctctc aaagctcatc agaaagtggc cataatgaga aacattgaga agatgcttgg agaggccttg gggaacccac aagaggtggg gcccttgttg aacacaatga tcaagggccg atacaactag. It is sometimes possible for the material contained within the vial of "HIF1AN, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.