Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GTPBP6 cdna clone

GTPBP6 cDNA Clone

Gene Names
GTPBP6; PGPL
Synonyms
GTPBP6; GTPBP6 cDNA Clone; GTPBP6 cdna clone
Ordering
For Research Use Only!
Sequence
atgactcgagccgagtggcaggtggcggaggccacagcgctggtgcacacgctggacggctggtccgtggtgcagacaatggtcgtgtccaccaaaacgccggacaggaagctcatctttggcaaagggaactttgagcacctgacagaaaagatccgagggtctccagacgtcacgtgcgtcttcctgaacgtggagaggatggctgccccgaccaagaaagaactggaagccgcctggggcgtggaggtgtttgaccgcttcacggtcgtcctgcacatcttccgctgtaacgcccgcacgaaggaggcccggcttcaggtggccctggcggagatgccgctgcacaggtcgaacttgaaaagggacgtcgcccacctgtaccgaggagtcggctcgcgctacatcatggggtcaggagaatccttcatgcagctgcagcagcgtctcctgagagagaaggaggccaagatcaggaaggccttggacaggcttcgcaagaagaggcacctgctccgccggcagcggacgaggcgggagttccccgtgatctccgtggtggggtacaccaactgcggaaagaccacgctgatcaaggcactgacgggcgatgccgccatccagccacgggaccagctgtttgccacgctggacgtcacggcccacgcgggcacgctgccctcacgcatgaccgtcctgtacgtggacaccatcggcttcctctcccagctgccgcacggcctcatcgagtccttctccgccaccctggaagacgtggcccactcggatctcatcttgcacgtgagggacgtcagccaccccgaggcggagctccagaaatgcagcgttctgtccacgctgcgtggcctgcagctgcccgccccgctcctggactccatggtggaggttcacaacaaggtggacctcgtgcccgggtacagccccacggaaccgaacgtcgtgcccgtgtctgccctgcggggccacgggctccaggagctgaaagctgagctcgatgcggcggttttgaaggcgacggggagacagatcctcactctccgtgtgaggctcgcaggggcgcagctcagctggctgtataaggaggccacagttcaggaggtggacgtgatccctgaggacggggcggccgacgtgagggtcatcatcagcaactcagcctacggcaaattccggaagctctttccaggatga
Sequence Length
1212
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
56,883 Da
NCBI Official Full Name
Homo sapiens GTP binding protein 6 (putative), mRNA
NCBI Official Synonym Full Names
GTP binding protein 6 (putative)
NCBI Official Symbol
GTPBP6
NCBI Official Synonym Symbols
PGPL
NCBI Protein Information
putative GTP-binding protein 6
UniProt Protein Name
Putative GTP-binding protein 6
UniProt Gene Name
GTPBP6
UniProt Synonym Gene Names
PGPL
UniProt Entry Name
GTPB6_HUMAN

NCBI Description

This gene encodes a GTP binding protein and is located in the pseudoautosomal region (PAR) at the end of the short arms of the X and Y chromosomes. [provided by RefSeq, Nov 2011]

Uniprot Description

GTPBP6: a GTP binding protein and is located in the pseudoautosomal region (PAR) at the end of the short arms of the X and Y chromosomes. [provided by RefSeq, Nov 2011]

Protein type: Hydrolase

Chromosomal Location of Human Ortholog: Xp22.33; Yp11.32

Cellular Component: cytoplasm

Molecular Function: ribosome binding

Similar Products

Product Notes

The GTPBP6 gtpbp6 (Catalog #AAA1269945) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgactcgag ccgagtggca ggtggcggag gccacagcgc tggtgcacac gctggacggc tggtccgtgg tgcagacaat ggtcgtgtcc accaaaacgc cggacaggaa gctcatcttt ggcaaaggga actttgagca cctgacagaa aagatccgag ggtctccaga cgtcacgtgc gtcttcctga acgtggagag gatggctgcc ccgaccaaga aagaactgga agccgcctgg ggcgtggagg tgtttgaccg cttcacggtc gtcctgcaca tcttccgctg taacgcccgc acgaaggagg cccggcttca ggtggccctg gcggagatgc cgctgcacag gtcgaacttg aaaagggacg tcgcccacct gtaccgagga gtcggctcgc gctacatcat ggggtcagga gaatccttca tgcagctgca gcagcgtctc ctgagagaga aggaggccaa gatcaggaag gccttggaca ggcttcgcaa gaagaggcac ctgctccgcc ggcagcggac gaggcgggag ttccccgtga tctccgtggt ggggtacacc aactgcggaa agaccacgct gatcaaggca ctgacgggcg atgccgccat ccagccacgg gaccagctgt ttgccacgct ggacgtcacg gcccacgcgg gcacgctgcc ctcacgcatg accgtcctgt acgtggacac catcggcttc ctctcccagc tgccgcacgg cctcatcgag tccttctccg ccaccctgga agacgtggcc cactcggatc tcatcttgca cgtgagggac gtcagccacc ccgaggcgga gctccagaaa tgcagcgttc tgtccacgct gcgtggcctg cagctgcccg ccccgctcct ggactccatg gtggaggttc acaacaaggt ggacctcgtg cccgggtaca gccccacgga accgaacgtc gtgcccgtgt ctgccctgcg gggccacggg ctccaggagc tgaaagctga gctcgatgcg gcggttttga aggcgacggg gagacagatc ctcactctcc gtgtgaggct cgcaggggcg cagctcagct ggctgtataa ggaggccaca gttcaggagg tggacgtgat ccctgaggac ggggcggccg acgtgagggt catcatcagc aactcagcct acggcaaatt ccggaagctc tttccaggat ga. It is sometimes possible for the material contained within the vial of "GTPBP6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.