GSDMB cdna clone
GSDMB cDNA Clone
Gene Names
GSDMB; GSDML; PP4052; PRO2521
Synonyms
GSDMB; GSDMB cDNA Clone; GSDMB cdna clone
Sequence
atgttcagcgtatttgaggaaatcacaagaattgtagttaaggagatggatgctggaggggatatgattgccgttagaagccttgttgatgctgatagattccgctgcttccatctggtgggggagaagagaactttctttggatgccggcactacacaacaggcctcaccctgatggacattctggacacagatggggacaagtggttagatgaactggattctgggctccaaggtcaaaaggctgagtttcaaattctggataatgtagactcaacgggagagttgatagtgagattacccaaagaaataacaatttcaggcagtttccagggcttccaccatcagaaaatcaagatatcggagaaccggatatcccagcagtatctggctacccttgaaaacaggaagctgaagagggaactacccttttcattccgatcaattaatacgagagaaaacctgtatctggtgacagaaactctggagacggtaaaggaggaaaccctgaaaagcgaccggcaatataaattttggagccagatctctcagggccatctcagctataaacacaagggccaaagggaagtgaccatccccccaaatcgggtcctgagctatcgagtaaagcagcttgtcttccccaacaaggagacgatgagtgctggtttggatattcatttcaggggcaaaacaaaatcctttccagaaggaaagtctttgggttcggaggattccagaaacatgaaggagaagttggaggacatggagagtgtcctcaaggacctgacagaggagaagagaaaagatgtgctaaactccctcgctaagtgcctcggcaaggaggatattcggcaggatctagagcaaagagtatctgaggtcctgatttccagggagctacacatggaggactcagacaagcctctcctaagcagcctttttaatgctgctggggtcttggtagaagcgcgtgcaaaagccattctggacttcctggatgccctcctagagctgtctgaagagcagcagtttgtggctgaggccctggagaaggggacccttcctctgttgaaggaccaggtgaaatctgtcatggagcagaactgggatgagctggccagcagtcctcctgacatggactatgaccctgaggcacgaattctctgtgcgctgtatgttgttgtctctatcctgctggagctggctgaggggcctacctctgtctcttcctaa
Sequence Length
1236
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
46,457 Da
NCBI Official Full Name
Homo sapiens gasdermin B, mRNA
NCBI Official Synonym Full Names
gasdermin B
NCBI Official Symbol
GSDMB
NCBI Official Synonym Symbols
GSDML; PP4052; PRO2521
NCBI Protein Information
gasdermin-B
UniProt Protein Name
Gasdermin-B
Protein Family
UniProt Gene Name
GSDMB
UniProt Synonym Gene Names
GSDML
UniProt Entry Name
GSDMB_HUMAN
NCBI Description
This gene encodes a member of the gasdermin-domain containing protein family. Other gasdermin-family genes are implicated in the regulation of apoptosis in epithelial cells, and are linked to cancer. Multiple transcript variants encoding different isoforms have been found for this gene. Additional variants have been described, but they are candidates for nonsense-mediated mRNA decay (NMD) and are unlikely to be protein-coding. [provided by RefSeq, Sep 2009]
Uniprot Description
GSDML: May play a role as secretory or metabolic product involved in secretory pathway. May also play a role in achieving and maintaining the final differentiation state of epithelial cells. Belongs to the gasdermin family. 6 isoforms of the human protein are produced by alternative splicing.
Chromosomal Location of Human Ortholog: 17q12
Research Articles on GSDMB
Similar Products
Product Notes
The GSDMB gsdmb (Catalog #AAA1277260) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttcagcg tatttgagga aatcacaaga attgtagtta aggagatgga tgctggaggg gatatgattg ccgttagaag ccttgttgat gctgatagat tccgctgctt ccatctggtg ggggagaaga gaactttctt tggatgccgg cactacacaa caggcctcac cctgatggac attctggaca cagatgggga caagtggtta gatgaactgg attctgggct ccaaggtcaa aaggctgagt ttcaaattct ggataatgta gactcaacgg gagagttgat agtgagatta cccaaagaaa taacaatttc aggcagtttc cagggcttcc accatcagaa aatcaagata tcggagaacc ggatatccca gcagtatctg gctacccttg aaaacaggaa gctgaagagg gaactaccct tttcattccg atcaattaat acgagagaaa acctgtatct ggtgacagaa actctggaga cggtaaagga ggaaaccctg aaaagcgacc ggcaatataa attttggagc cagatctctc agggccatct cagctataaa cacaagggcc aaagggaagt gaccatcccc ccaaatcggg tcctgagcta tcgagtaaag cagcttgtct tccccaacaa ggagacgatg agtgctggtt tggatattca tttcaggggc aaaacaaaat cctttccaga aggaaagtct ttgggttcgg aggattccag aaacatgaag gagaagttgg aggacatgga gagtgtcctc aaggacctga cagaggagaa gagaaaagat gtgctaaact ccctcgctaa gtgcctcggc aaggaggata ttcggcagga tctagagcaa agagtatctg aggtcctgat ttccagggag ctacacatgg aggactcaga caagcctctc ctaagcagcc tttttaatgc tgctggggtc ttggtagaag cgcgtgcaaa agccattctg gacttcctgg atgccctcct agagctgtct gaagagcagc agtttgtggc tgaggccctg gagaagggga cccttcctct gttgaaggac caggtgaaat ctgtcatgga gcagaactgg gatgagctgg ccagcagtcc tcctgacatg gactatgacc ctgaggcacg aattctctgt gcgctgtatg ttgttgtctc tatcctgctg gagctggctg aggggcctac ctctgtctct tcctaa. It is sometimes possible for the material contained within the vial of "GSDMB, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
