Map
GPX8 cdna clone
GPX8 cDNA Clone
Gene Names
GPX8; GPx-8; UNQ847; EPLA847; GSHPx-8
Synonyms
GPX8; GPX8 cDNA Clone; UNQ847; GPX8 cdna clone
Sequence
atggagcctcttgcagcttacccgctaaaatgttccgggcccagagcaaaggtatttgcagttttgctgtctatagttctatgcacagtaacgctatttcttctacaactaaaattcctcaaacctaaaatcaacagcttttatgcctttgaagtgaaggatgcaaaaggaagaactgtttctctggaaaagtataaaggcaaagtttcactagttgtaaacgtggccagtgactgccaactcacagacagaaattacttagggctgaaggaactgcacaaagagtttggaccatcccacttcagcgtgttggcttttccctgcaatcagtttggagaatcggagccccgcccaagcaaggaagtagaatcttttgcaagaaaaaactacggagtaactttccccatcttccacaagattaagattctaggatctgaaggagaacctgcatttagatttcttgttgattcttcaaagaaggaaccaaggtggaatttttggaagtatcttgtcaaccctgagggtcaagttgtgaagttctggaggccagaggagcccattgaagtcatcaggcctgacatagcagctctggttagacaagtgatcataaaaaagaaagaggatctatga
Sequence Length
630
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
Map
Map
Related Product Information for GPX8 cdna clone
Homo sapiens glutathione peroxidase 8 (putative), mRNA (cDNA clone MGC:32677 IMAGE:4285958), complete cds.
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
23,881 Da
NCBI Official Full Name
Homo sapiens glutathione peroxidase 8 (putative), mRNA
NCBI Official Synonym Full Names
glutathione peroxidase 8 (putative)
NCBI Official Symbol
GPX8
NCBI Official Synonym Symbols
GPx-8; UNQ847; EPLA847; GSHPx-8
NCBI Protein Information
probable glutathione peroxidase 8
UniProt Protein Name
Probable glutathione peroxidase 8
Protein Family
UniProt Gene Name
GPX8
UniProt Synonym Gene Names
GPx-8; GSHPx-8
UniProt Entry Name
GPX8_HUMAN
Uniprot Description
GPX8: Belongs to the glutathione peroxidase family.
Protein type: EC 1.11.1.9; Oxidoreductase; Membrane protein, integral
Chromosomal Location of Human Ortholog: 5q11.2
Cellular Component: endoplasmic reticulum lumen
Molecular Function: peroxidase activity
Biological Process: response to reactive oxygen species
Research Articles on GPX8
1. GPX8 is transcriptionally regulated by HIFalpha and modulates growth factor signaling in HeLa cells.
Similar Products
Product Notes
The GPX8 gpx8 (Catalog #AAA1270922) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagcctc ttgcagctta cccgctaaaa tgttccgggc ccagagcaaa ggtatttgca gttttgctgt ctatagttct atgcacagta acgctatttc ttctacaact aaaattcctc aaacctaaaa tcaacagctt ttatgccttt gaagtgaagg atgcaaaagg aagaactgtt tctctggaaa agtataaagg caaagtttca ctagttgtaa acgtggccag tgactgccaa ctcacagaca gaaattactt agggctgaag gaactgcaca aagagtttgg accatcccac ttcagcgtgt tggcttttcc ctgcaatcag tttggagaat cggagccccg cccaagcaag gaagtagaat cttttgcaag aaaaaactac ggagtaactt tccccatctt ccacaagatt aagattctag gatctgaagg agaacctgca tttagatttc ttgttgattc ttcaaagaag gaaccaaggt ggaatttttg gaagtatctt gtcaaccctg agggtcaagt tgtgaagttc tggaggccag aggagcccat tgaagtcatc aggcctgaca tagcagctct ggttagacaa gtgatcataa aaaagaaaga ggatctatga. It is sometimes possible for the material contained within the vial of "GPX8, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
