Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

Vector Map

ANXA2 cdna clone

ANXA2 cDNA Clone

Gene Names
ANXA2; P36; ANX2; LIP2; LPC2; CAL1H; LPC2D; ANX2L4; PAP-IV
Synonyms
ANXA2; ANXA2 cDNA Clone; ANXA2 cdna clone
Ordering
For Research Use Only!
Sequence
atgtctactgttcacgaaatcctgtgcaagctcagcttggagggtgatcactctacacccccaagtgcatatgggtctgtcaaagcctatactaactttgatgctgagcgggatgctttgaacattgaaacagccatcaagaccaaaggtgtggatgaggtcaccattgtcaacattttgaccaaccgcagcaatgcacagagacaggatattgccttcgcctaccagagaaggaccaaaaaggaacttgcatcagcactgaagtcagccttatctggccacctggagacgttgattttgggcctattgaagacacctgctcagtatgacgcttctgagctaaaagcttccatgaaggggctgggaaccgacgaggactctctcattgagatcatctgctccagaaccaaccaggagctgcaggaaattaacagagtctacaaggaaatgtacaagactgatctggagaaggacattatttcggacacatctggtgacttccgcaagctgatggttgccctggcaaagggtagaagagcagaggatggctctgtcattgattatgaactgattgaccaagatgctcgggatctctatgacgctggagtgaagaggaaaggaactgatgttcccaagtggatcagcatcatgaccgagcggagcgtgccccacctccagaaagtatttgataggtacaagagttacagcccttatgacatgttggaaagcatcaggaaagaggttaaaggagacctggaaaatgctttcctgaacctggttcagtgcattcagaacaagcccctgtattttgctgatcggctgtatgactccatgaagggcaaggggacgcgagataaggtcctgatcagaatcatggtctcccgcagtgaagtggacatgttgaaaattaggtctgaattcaagagaaagtacggcaagtccctgtactattatatccagcaagacactaagggcgactaccagaaagcgctgctgtacctgtgtggtggagatgactga
Sequence Length
1020
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

Vector Map

Vector Map
Related Product Information for ANXA2 cdna clone
Homo sapiens annexin A2, mRNA (cDNA clone MGC:10129 IMAGE:3901641),complete cds.

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
302
UniProt Accession #
Molecular Weight
38,604 Da
NCBI Official Full Name
Homo sapiens annexin A2, mRNA
NCBI Official Synonym Full Names
annexin A2
NCBI Official Symbol
ANXA2
NCBI Official Synonym Symbols
P36; ANX2; LIP2; LPC2; CAL1H; LPC2D; ANX2L4; PAP-IV
NCBI Protein Information
annexin A2; annexin-2; protein I; annexin II; lipocortin II; chromobindin 8; chromobindin-8; calpactin I heavy chain; calpactin-1 heavy chain; calpactin I heavy polypeptide; placental anticoagulant protein IV
UniProt Protein Name
Annexin A2
Protein Family
UniProt Gene Name
ANXA2
UniProt Synonym Gene Names
ANX2; ANX2L4; CAL1H; LPC2D; PAP-IV
UniProt Entry Name
ANXA2_HUMAN

NCBI Description

This gene encodes a member of the annexin family. Members of this calcium-dependent phospholipid-binding protein family play a role in the regulation of cellular growth and in signal transduction pathways. This protein functions as an autocrine factor which heightens osteoclast formation and bone resorption. This gene has three pseudogenes located on chromosomes 4, 9 and 10, respectively. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

ANXA2: a calcium-regulated membrane-binding protein whose affinity for calcium is greatly enhanced by anionic phospholipids. It binds two calcium ions with high affinity. Heterotetramer containing 2 light chains of S100A10 2 heavy chains of ANXA2. May cross-link plasma membrane phospholipids with actin and the cytoskeleton and be involved with exocytosis. Annexins are a family of structurally related proteins whose common property is calcium-dependent binding to phospholipids. There are at least ten different annexins in mammalian species. Annexins do not contain signal peptides, yet some annexins (A1, A2 and A5) appear to be secreted in a physiologically regulated fashion.

Protein type: Calcium-binding; Lipid-binding; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 15q22.2

Cellular Component: extrinsic to plasma membrane; extracellular space; cell surface; protein complex; late endosome membrane; lysosomal membrane; early endosome; lipid particle; cell cortex; lipid raft; ruffle; extracellular matrix; membrane; perinuclear region of cytoplasm; melanosome; plasma membrane; basement membrane; midbody; nucleus; endosome; vesicle; sarcolemma

Molecular Function: protein binding; phosphatidylinositol-4,5-bisphosphate binding; calcium-dependent phospholipid binding; phospholipase A2 inhibitor activity; cytoskeletal protein binding; calcium ion binding; calcium-dependent protein binding; Rab GTPase binding

Biological Process: fibrinolysis; positive regulation of fibroblast proliferation; collagen fibril organization; negative regulation of catalytic activity; protein heterotetramerization; positive regulation of vesicle fusion; angiogenesis; positive regulation of protein amino acid phosphorylation; positive regulation of binding; lipid raft formation; body fluid secretion; membrane budding

Research Articles on ANXA2

Similar Products

Product Notes

The ANXA2 anxa2 (Catalog #AAA1276377) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctactg ttcacgaaat cctgtgcaag ctcagcttgg agggtgatca ctctacaccc ccaagtgcat atgggtctgt caaagcctat actaactttg atgctgagcg ggatgctttg aacattgaaa cagccatcaa gaccaaaggt gtggatgagg tcaccattgt caacattttg accaaccgca gcaatgcaca gagacaggat attgccttcg cctaccagag aaggaccaaa aaggaacttg catcagcact gaagtcagcc ttatctggcc acctggagac gttgattttg ggcctattga agacacctgc tcagtatgac gcttctgagc taaaagcttc catgaagggg ctgggaaccg acgaggactc tctcattgag atcatctgct ccagaaccaa ccaggagctg caggaaatta acagagtcta caaggaaatg tacaagactg atctggagaa ggacattatt tcggacacat ctggtgactt ccgcaagctg atggttgccc tggcaaaggg tagaagagca gaggatggct ctgtcattga ttatgaactg attgaccaag atgctcggga tctctatgac gctggagtga agaggaaagg aactgatgtt cccaagtgga tcagcatcat gaccgagcgg agcgtgcccc acctccagaa agtatttgat aggtacaaga gttacagccc ttatgacatg ttggaaagca tcaggaaaga ggttaaagga gacctggaaa atgctttcct gaacctggtt cagtgcattc agaacaagcc cctgtatttt gctgatcggc tgtatgactc catgaagggc aaggggacgc gagataaggt cctgatcaga atcatggtct cccgcagtga agtggacatg ttgaaaatta ggtctgaatt caagagaaag tacggcaagt ccctgtacta ttatatccag caagacacta agggcgacta ccagaaagcg ctgctgtacc tgtgtggtgg agatgactga. It is sometimes possible for the material contained within the vial of "ANXA2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.