Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GPR15 cdna clone

GPR15 cDNA Clone

Gene Names
GPR15; BOB
Synonyms
GPR15; GPR15 cDNA Clone; GPR15 cdna clone
Ordering
For Research Use Only!
Sequence
atggacccagaagaaacttcagtttatttggattattactatgctacgagcccaaactctgacatcagggagacccactcccatgttccttacacctctgtcttccttccagtcttttacacagctgtgttcctgactggagtgctggggaaccttgttctcatgggagcgttgcatttcaaacccggcagccgaagactgatcgacatctttatcatcaatctggctgcctctgacttcatttttcttgtcacattgcctctctgggtggataaagaagcatctctaggactgtggaggacgggctccttcctgtgcaaagggagctcctacatgatctccgtcaatatgcactgcagtgtcctcctgctcacttgcatgagtgttgaccgctacctggccattgtgtggccagtcgtatccaggaaattcagaaggacagactgtgcatatgtagtctgtgccagcatctggtttatctcctgcctgctggggttgcctactcttctgtccagggagctcacgctgattgatgataagccatactgtgcagagaaaaaggcaactccaattaaactcatatggtccctggtggccttaattttcaccttttttgtccctttgttgagcattgtgacctgctactgttgcattgcaaggaagctgtgtgcccattaccagcaatcaggaaagcacaacaaaaagctgaagaaatctataaagatcatctttattgtcgtggcagcctttcttgtctcctggctgcccttcaatactttcaagttcctggccattgtctctgggttgcggcaagaacactatttaccctcagctattcttcagcttggtatggaggtgagtggacccttggcatttgccaacagctgtgtcaaccctttcatttactatatcttcgacagctacatccgccgggccattgtccactgcttgtgcccttgcctgaaaaactatgactttgggagtagcactgagacatcagatagtcacctcactaaggctctctccaccttcattcatgcagaagattttgccaggaggaggaagaggtctgtgtcactctaa
Sequence Length
1083
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
40,787 Da
NCBI Official Full Name
Homo sapiens G protein-coupled receptor 15, mRNA
NCBI Official Synonym Full Names
G protein-coupled receptor 15
NCBI Official Symbol
GPR15
NCBI Official Synonym Symbols
BOB
NCBI Protein Information
G-protein coupled receptor 15
UniProt Protein Name
G-protein coupled receptor 15
UniProt Gene Name
GPR15
UniProt Synonym Gene Names
BoB
UniProt Entry Name
GPR15_HUMAN

NCBI Description

This gene encodes a G protein-coupled receptor that acts as a chemokine receptor for human immunodeficiency virus type 1 and 2. The encoded protein localizes to the cell membrane. [provided by RefSeq, Nov 2012]

Uniprot Description

GPR15: Probable chemokine receptor. Alternative coreceptor with CD4 for HIV-1 infection. Belongs to the G-protein coupled receptor 1 family.

Protein type: Membrane protein, multi-pass; GPCR, family 1; Membrane protein, integral; Receptor, GPCR

Chromosomal Location of Human Ortholog: 3q11.2-q13.1

Cellular Component: integral to plasma membrane; plasma membrane

Research Articles on GPR15

Similar Products

Product Notes

The GPR15 gpr15 (Catalog #AAA1269334) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacccag aagaaacttc agtttatttg gattattact atgctacgag cccaaactct gacatcaggg agacccactc ccatgttcct tacacctctg tcttccttcc agtcttttac acagctgtgt tcctgactgg agtgctgggg aaccttgttc tcatgggagc gttgcatttc aaacccggca gccgaagact gatcgacatc tttatcatca atctggctgc ctctgacttc atttttcttg tcacattgcc tctctgggtg gataaagaag catctctagg actgtggagg acgggctcct tcctgtgcaa agggagctcc tacatgatct ccgtcaatat gcactgcagt gtcctcctgc tcacttgcat gagtgttgac cgctacctgg ccattgtgtg gccagtcgta tccaggaaat tcagaaggac agactgtgca tatgtagtct gtgccagcat ctggtttatc tcctgcctgc tggggttgcc tactcttctg tccagggagc tcacgctgat tgatgataag ccatactgtg cagagaaaaa ggcaactcca attaaactca tatggtccct ggtggcctta attttcacct tttttgtccc tttgttgagc attgtgacct gctactgttg cattgcaagg aagctgtgtg cccattacca gcaatcagga aagcacaaca aaaagctgaa gaaatctata aagatcatct ttattgtcgt ggcagccttt cttgtctcct ggctgccctt caatactttc aagttcctgg ccattgtctc tgggttgcgg caagaacact atttaccctc agctattctt cagcttggta tggaggtgag tggacccttg gcatttgcca acagctgtgt caaccctttc atttactata tcttcgacag ctacatccgc cgggccattg tccactgctt gtgcccttgc ctgaaaaact atgactttgg gagtagcact gagacatcag atagtcacct cactaaggct ctctccacct tcattcatgc agaagatttt gccaggagga ggaagaggtc tgtgtcactc taa. It is sometimes possible for the material contained within the vial of "GPR15, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.