Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GALK2 cdna clone

GALK2 cDNA Clone

Gene Names
GALK2; GK2
Synonyms
GALK2; GALK2 cDNA Clone; GALK2 cdna clone
Ordering
For Research Use Only!
Sequence
atggctacagagagccctgctacgcgtcgggtccaggtggcagaacatcctaggttactgaagctaaaggagatgtttaactccaagtttggatctattcccaagttttatgttcgagcaccaggaagagtcaacataataggagagcatatagattattgtggatattctgttcttcctatggctgtagaacaagatgtgctaatagctgtagaacctgtgaaaacgtacgctctccaactggccaatacaaatcccttgtatccggacttcagtactagtgctaataacatccagattgataaaaccaagcctttgtggcacaactatttcttatgtggacttaaaggaattcaggaacactttggtcttagtaacctgactggaatgaactgcctggtagatggaaatatcccaccaagttctggcctctccagctccagtgctttggtctgttgtgctggcttggtgacgctcacagtgctgggaaggaatctatccaaggtggaacttgcagaaatctgtgccaagagtgagcgttacattggcactgaaggaggaggcatggaccagtctatatcatttcttgcagaagaaggaactgccaagttgatagaatttagtcctctgagggcaaccgatgtaaaactcccaagtggagcagtgtttgtgattgccaacagttgtgtggagatgaataaggcagcaacttcccatttcaatatcagggtgatggagtgtcggctggctgcgaagctcctggctaaatacaaaagcttgcaatgggacaaagtactgaggctggaggaggtgcaggctaaactagggattagtctagaagaaatgctgttggtcacagaagatgcccttcatcctgaaccctataaccctgaggagatctgcaggtgtctgggaattagcctggaggaactccgaacccaaatcctgagtccaaacactcaagatgtgctcatcttcaaactctatcagcgggcaaagcatgtgtacagcgaggctgcgcgagtgctccagtttaagaagatatgtgaagaagcacctgaaaacatggtccagctgctgggagagttgatgaaccagagccacatgagctgccgggacatgtatgagtgcagctgccccgagctggatcagctggtggacatctgtcggaagtttggggctcaagggtcacgacttactggagcaggatggggaggctgtacagtatcaatggtacctgcggacaagctgcccagctttctagcaaatgtgcacaaagcttattaccagaggagtgatggaagcttagcaccggagaagcaaagtttgtttgctaccaaacctggaggtggggctttggttttgcttgaggcctga
Sequence Length
1377
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
49,235 Da
NCBI Official Full Name
Homo sapiens galactokinase 2, mRNA
NCBI Official Synonym Full Names
galactokinase 2
NCBI Official Symbol
GALK2
NCBI Official Synonym Symbols
GK2
NCBI Protein Information
N-acetylgalactosamine kinase
UniProt Protein Name
N-acetylgalactosamine kinase
UniProt Gene Name
GALK2
UniProt Synonym Gene Names
GK2
UniProt Entry Name
GALK2_HUMAN

NCBI Description

This gene encodes a highly efficient N-acetylgalactosamine (GalNAc) kinase, which has galactokinase activity when galactose is present at high concentrations. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2014]

Uniprot Description

GALK2: Acts on GalNAc. Also acts as a galactokinase when galactose is present at high concentrations. May be involved in a salvage pathway for the reutilization of free GalNAc derived from the degradation of complex carbohydrates. Belongs to the GHMP kinase family. GalK subfamily. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Carbohydrate Metabolism - galactose; EC 2.7.1.157; Kinase, other; Carbohydrate Metabolism - amino sugar and nucleotide sugar

Chromosomal Location of Human Ortholog: 15q21.1-q21.2

Molecular Function: galactokinase activity

Biological Process: carbohydrate metabolic process

Research Articles on GALK2

Similar Products

Product Notes

The GALK2 galk2 (Catalog #AAA1272087) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctacag agagccctgc tacgcgtcgg gtccaggtgg cagaacatcc taggttactg aagctaaagg agatgtttaa ctccaagttt ggatctattc ccaagtttta tgttcgagca ccaggaagag tcaacataat aggagagcat atagattatt gtggatattc tgttcttcct atggctgtag aacaagatgt gctaatagct gtagaacctg tgaaaacgta cgctctccaa ctggccaata caaatccctt gtatccggac ttcagtacta gtgctaataa catccagatt gataaaacca agcctttgtg gcacaactat ttcttatgtg gacttaaagg aattcaggaa cactttggtc ttagtaacct gactggaatg aactgcctgg tagatggaaa tatcccacca agttctggcc tctccagctc cagtgctttg gtctgttgtg ctggcttggt gacgctcaca gtgctgggaa ggaatctatc caaggtggaa cttgcagaaa tctgtgccaa gagtgagcgt tacattggca ctgaaggagg aggcatggac cagtctatat catttcttgc agaagaagga actgccaagt tgatagaatt tagtcctctg agggcaaccg atgtaaaact cccaagtgga gcagtgtttg tgattgccaa cagttgtgtg gagatgaata aggcagcaac ttcccatttc aatatcaggg tgatggagtg tcggctggct gcgaagctcc tggctaaata caaaagcttg caatgggaca aagtactgag gctggaggag gtgcaggcta aactagggat tagtctagaa gaaatgctgt tggtcacaga agatgccctt catcctgaac cctataaccc tgaggagatc tgcaggtgtc tgggaattag cctggaggaa ctccgaaccc aaatcctgag tccaaacact caagatgtgc tcatcttcaa actctatcag cgggcaaagc atgtgtacag cgaggctgcg cgagtgctcc agtttaagaa gatatgtgaa gaagcacctg aaaacatggt ccagctgctg ggagagttga tgaaccagag ccacatgagc tgccgggaca tgtatgagtg cagctgcccc gagctggatc agctggtgga catctgtcgg aagtttgggg ctcaagggtc acgacttact ggagcaggat ggggaggctg tacagtatca atggtacctg cggacaagct gcccagcttt ctagcaaatg tgcacaaagc ttattaccag aggagtgatg gaagcttagc accggagaag caaagtttgt ttgctaccaa acctggaggt ggggctttgg ttttgcttga ggcctga. It is sometimes possible for the material contained within the vial of "GALK2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.