Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FHL3 cdna clone

FHL3 cDNA Clone

Gene Names
FHL3; SLIM2
Synonyms
FHL3; FHL3 cDNA Clone; FHL3 cdna clone
Ordering
For Research Use Only!
Sequence
atgcctgggtcccggaagctggaatatggaggccagacatggcatgagcactgcttcctgtgcagtggctgtgaacagccactgggctcccgttcttttgtgcccgacaagggtgctcactactgcgtgccctgctatgagaacaagtttgctcctcgctgcgcccgctgcagcaagacgctgacacagggtggagtgacataccgtgatcagccatggcatcgagaatgtctggtctgtaccggatgccagacgcccctggcagggcagcagttcacctcccgggatgaagatccctactgtgtggcctgttttggagaactctttgcacctaagtgcagcagctgcaagcgccccatcgtaggactcggtggaggcaagtatgtgtcctttgaagaccgacactggcaccacaactgcttctcctgcgcccgctgctctacctccctggtgggccagggcttcgtaccggatggagaccaagtgctctgccagggctgtagccaggcagggccctaa
Sequence Length
519
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
31,192 Da
NCBI Official Full Name
Homo sapiens four and a half LIM domains 3, mRNA
NCBI Official Synonym Full Names
four and a half LIM domains 3
NCBI Official Symbol
FHL3
NCBI Official Synonym Symbols
SLIM2
NCBI Protein Information
four and a half LIM domains protein 3
UniProt Protein Name
Four and a half LIM domains protein 3
UniProt Gene Name
FHL3
UniProt Synonym Gene Names
SLIM2; FHL-3; SLIM-2
UniProt Entry Name
FHL3_HUMAN

NCBI Description

The protein encoded by this gene is a member of a family of proteins containing a four-and-a-half LIM domain, which is a highly conserved double zinc finger motif. The encoded protein has been shown to interact with the cancer developmental regulators SMAD2, SMAD3, and SMAD4, the skeletal muscle myogenesis protein MyoD, and the high-affinity IgE beta chain regulator MZF-1. This protein may be involved in tumor suppression, repression of MyoD expression, and repression of IgE receptor expression. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]

Uniprot Description

FHL3:

Protein type: Actin-binding; Contractile

Chromosomal Location of Human Ortholog: 1p34

Cellular Component: focal adhesion

Molecular Function: protein binding

Biological Process: muscle development

Research Articles on FHL3

Similar Products

Product Notes

The FHL3 fhl3 (Catalog #AAA1273167) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcctgggt cccggaagct ggaatatgga ggccagacat ggcatgagca ctgcttcctg tgcagtggct gtgaacagcc actgggctcc cgttcttttg tgcccgacaa gggtgctcac tactgcgtgc cctgctatga gaacaagttt gctcctcgct gcgcccgctg cagcaagacg ctgacacagg gtggagtgac ataccgtgat cagccatggc atcgagaatg tctggtctgt accggatgcc agacgcccct ggcagggcag cagttcacct cccgggatga agatccctac tgtgtggcct gttttggaga actctttgca cctaagtgca gcagctgcaa gcgccccatc gtaggactcg gtggaggcaa gtatgtgtcc tttgaagacc gacactggca ccacaactgc ttctcctgcg cccgctgctc tacctccctg gtgggccagg gcttcgtacc ggatggagac caagtgctct gccagggctg tagccaggca gggccctaa. It is sometimes possible for the material contained within the vial of "FHL3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.