Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FAM175B cdna clone

FAM175B cDNA Clone

Gene Names
FAM175B; ABRO1; KIAA0157
Synonyms
FAM175B; FAM175B cDNA Clone; FAM175B cdna clone
Ordering
For Research Use Only!
Sequence
atgtcctacagagagcaggttcttcacaagcagctcacccgcatcctcggcgtgcccgacctcgtctttcttctcttcagcttcatctccactgccaacaattccactcacgctttagaatatgtgctcttcagaccaaatagaaggtataatcagaggatatcactcgctattcccaatctaggaaatactagccagcaagagtacaaagtgtcttcagtgccaaatacttctcagagttatgccaaagtgattaaagaacatggtactgacttttttgacaaggatggagtgatgaaagacatcagggcgatttatcaggtttataatgcacttcaggagaaagttcaggcagtgtgtgcagatgttgaaaagagtgagcgagttgttgaatcttgtcaggcagaagtgaacaaattaagaagacaaatcactcagaggaaaaatgaaaaggaacaagaaagaagattgcagcaggcagtgttaagcagacagatgccgtctgaaagcttggacccagcgttcagtcctcggatgccgtcctctgggtttgcagctgaaggcagaagtacacttggagatgcagaggcctcggatcctcctcccccttactctgattttcacccaaacaatcaagaaagtactttgagccactctcgcatggaaaggagtgtctttatgcctcgacctcaagctgtgggctcttccaattatgcttccaccagtgccggactgaagtatcctggaagtggggctgaccttcctcctccccaaagagcagctggagacagtggtgaggattcagacgacagtgattatgaaaatttgattgaccctacagagccttctaatagtgaatactcacattcaaaggattctcgacccatggcacatcccgacgaggaccccaggaacactcagacctcccagatttaa
Sequence Length
936
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
46,901 Da
NCBI Official Full Name
Homo sapiens family with sequence similarity 175, member B, mRNA
NCBI Official Synonym Full Names
family with sequence similarity 175 member B
NCBI Official Symbol
FAM175B
NCBI Official Synonym Symbols
ABRO1; KIAA0157
NCBI Protein Information
BRISC complex subunit Abro1
UniProt Protein Name
BRISC complex subunit Abro1
Protein Family
UniProt Gene Name
FAM175B
UniProt Entry Name
F175B_HUMAN

Uniprot Description

FAM175B: a protein of unknown function.

Protein type: Ubiquitin conjugating system

Chromosomal Location of Human Ortholog: 10q26.13

Cellular Component: centrosome; cytoplasm; midbody; spindle pole centrosome

Molecular Function: microtubule binding; polyubiquitin binding

Biological Process: attachment of spindle microtubules to kinetochore; chromosome segregation; mitotic cell cycle

Research Articles on FAM175B

Similar Products

Product Notes

The FAM175B fam175b (Catalog #AAA1273765) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcctaca gagagcaggt tcttcacaag cagctcaccc gcatcctcgg cgtgcccgac ctcgtctttc ttctcttcag cttcatctcc actgccaaca attccactca cgctttagaa tatgtgctct tcagaccaaa tagaaggtat aatcagagga tatcactcgc tattcccaat ctaggaaata ctagccagca agagtacaaa gtgtcttcag tgccaaatac ttctcagagt tatgccaaag tgattaaaga acatggtact gacttttttg acaaggatgg agtgatgaaa gacatcaggg cgatttatca ggtttataat gcacttcagg agaaagttca ggcagtgtgt gcagatgttg aaaagagtga gcgagttgtt gaatcttgtc aggcagaagt gaacaaatta agaagacaaa tcactcagag gaaaaatgaa aaggaacaag aaagaagatt gcagcaggca gtgttaagca gacagatgcc gtctgaaagc ttggacccag cgttcagtcc tcggatgccg tcctctgggt ttgcagctga aggcagaagt acacttggag atgcagaggc ctcggatcct cctccccctt actctgattt tcacccaaac aatcaagaaa gtactttgag ccactctcgc atggaaagga gtgtctttat gcctcgacct caagctgtgg gctcttccaa ttatgcttcc accagtgccg gactgaagta tcctggaagt ggggctgacc ttcctcctcc ccaaagagca gctggagaca gtggtgagga ttcagacgac agtgattatg aaaatttgat tgaccctaca gagccttcta atagtgaata ctcacattca aaggattctc gacccatggc acatcccgac gaggacccca ggaacactca gacctcccag atttaa. It is sometimes possible for the material contained within the vial of "FAM175B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.