Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ERAL1 cdna clone

ERAL1 cDNA Clone

Gene Names
ERAL1; ERA; CEGA; ERA-W; H-ERA; ERAL1A; HERA-A; HERA-B
Synonyms
ERAL1; ERAL1 cDNA Clone; ERAL1 cdna clone
Ordering
For Research Use Only!
Sequence
atggctgcccccagctggcgcggggctaggcttgttcaatcggtgttaagagtctggcaggtgggccctcatgtcgcgagggagcgggtgatccctttttcctcactcttaggcttccaacggaggtgcgtgtcctgcgtcgcggggtccgctttctctggtccccgcttggcctcggcttctcgcagtaatggccagggctctgccctggaccacttcctcggattctctcagcccgacagttcggtgactccttgcgtccccgcggtgtccatgaacagagatgagcaggatgtcctcttggtccatcaccctgatatgcctgagaattcccgggtcctacgagtggtcctcctgggagccccgaatgcagggaagtcaacactctccaaccagctactgggccgaaaggtgttccctgtttccaggaaggtgcatactactcgctgccaagctctgggggtcatcacagagaaggagacccaggtgattctacttgacacacctggcattatcagtcctggtaaacagaagaggcatcacctggagctctctttgttggaagatccatggaagagcatggaatctgctgatcttgttgtggttcttgtggatgtctcagacaagtggacacggaaccagctcagcccccagttgctcaggtgcttgaccaagtactcccagatccctagtgtcctggtcatgaacaaggtagattgtttgaagcagaagtcagttctcctggagctcacggcagccctcactgaaggtgtggtcaatggcaaaaagctcaagatgaggcaggccttccactcacaccctggcacccattgccccagcccagcagttaaggacccaaacacacaatctgtgggaaatcctcagaggattggctggccccacttcaaggagatcttcatgttgtcagccctaagccaggaggacgtgaaaacactaaagcaataccttctgacacaggcccagccagggccctgggagtaccacagtgcagtcctcactagccagacaccagaagagatctgtgccaacattatccgagagaagctcctagaacacctgccccaggaggtgccttacaatgtacagcagaagacagcagtgtgggaggaaggaccaggtggggagctggttatccaacagaagcttctggtgcccaaagaatcttatgtgaaactcctgattggtccgaagggccacgtgatctcccagatagcacaggaggcaggccatgacctcatggacatcttcctctgcgatgttgacatccgcctctctgtgaagctcctcaagtga
Sequence Length
1314
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
30,040 Da
NCBI Official Full Name
Homo sapiens Era G-protein-like 1 (E. coli), mRNA
NCBI Official Synonym Full Names
Era like 12S mitochondrial rRNA chaperone 1
NCBI Official Symbol
ERAL1
NCBI Official Synonym Symbols
ERA; CEGA; ERA-W; H-ERA; ERAL1A; HERA-A; HERA-B
NCBI Protein Information
GTPase Era, mitochondrial
UniProt Protein Name
GTPase Era, mitochondrial
UniProt Gene Name
ERAL1
UniProt Synonym Gene Names
HERA; H-ERA; hERA; CEGA
UniProt Entry Name
ERAL1_HUMAN

NCBI Description

The protein encoded by this gene is a GTPase that localizes to the mitochondrion. The encoded protein binds to the 3' terminal stem loop of 12S mitochondrial rRNA and is required for proper assembly of the 28S small mitochondrial ribosomal subunit. Deletion of this gene has been shown to cause mitochondrial dysfunction, growth retardation, and apoptosis. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]

Uniprot Description

ERAL1: Probable GTPase that plays a role in the mitochondrial ribosomal small subunit assembly. Specifically binds the 12S mitochondrial rRNA (12S mt-rRNA) to a 33 nucleotide section delineating the 3' terminal stem-loop region. May act as a chaperone that protects the 12S mt-rRNA on the 28S mitoribosomal subunit during ribosomal small subunit assembly. Belongs to the Era/MnmE GTP-binding protein family. Era subfamily. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Mitochondrial

Chromosomal Location of Human Ortholog: 17q11.2

Cellular Component: actin cytoskeleton; cytoplasm; intermediate filament cytoskeleton; mitochondrial matrix; mitochondrion

Molecular Function: GTP binding; GTPase activity; protein binding; ribosomal small subunit binding; rRNA binding

Biological Process: ribosomal small subunit assembly and maintenance

Research Articles on ERAL1

Similar Products

Product Notes

The ERAL1 eral1 (Catalog #AAA1266211) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctgccc ccagctggcg cggggctagg cttgttcaat cggtgttaag agtctggcag gtgggccctc atgtcgcgag ggagcgggtg atcccttttt cctcactctt aggcttccaa cggaggtgcg tgtcctgcgt cgcggggtcc gctttctctg gtccccgctt ggcctcggct tctcgcagta atggccaggg ctctgccctg gaccacttcc tcggattctc tcagcccgac agttcggtga ctccttgcgt ccccgcggtg tccatgaaca gagatgagca ggatgtcctc ttggtccatc accctgatat gcctgagaat tcccgggtcc tacgagtggt cctcctggga gccccgaatg cagggaagtc aacactctcc aaccagctac tgggccgaaa ggtgttccct gtttccagga aggtgcatac tactcgctgc caagctctgg gggtcatcac agagaaggag acccaggtga ttctacttga cacacctggc attatcagtc ctggtaaaca gaagaggcat cacctggagc tctctttgtt ggaagatcca tggaagagca tggaatctgc tgatcttgtt gtggttcttg tggatgtctc agacaagtgg acacggaacc agctcagccc ccagttgctc aggtgcttga ccaagtactc ccagatccct agtgtcctgg tcatgaacaa ggtagattgt ttgaagcaga agtcagttct cctggagctc acggcagccc tcactgaagg tgtggtcaat ggcaaaaagc tcaagatgag gcaggccttc cactcacacc ctggcaccca ttgccccagc ccagcagtta aggacccaaa cacacaatct gtgggaaatc ctcagaggat tggctggccc cacttcaagg agatcttcat gttgtcagcc ctaagccagg aggacgtgaa aacactaaag caataccttc tgacacaggc ccagccaggg ccctgggagt accacagtgc agtcctcact agccagacac cagaagagat ctgtgccaac attatccgag agaagctcct agaacacctg ccccaggagg tgccttacaa tgtacagcag aagacagcag tgtgggagga aggaccaggt ggggagctgg ttatccaaca gaagcttctg gtgcccaaag aatcttatgt gaaactcctg attggtccga agggccacgt gatctcccag atagcacagg aggcaggcca tgacctcatg gacatcttcc tctgcgatgt tgacatccgc ctctctgtga agctcctcaa gtga. It is sometimes possible for the material contained within the vial of "ERAL1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.