Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

EPHA4 cdna clone

EPHA4 cDNA Clone

Gene Names
EPHA4; SEK; HEK8; TYRO1
Synonyms
EPHA4; EPHA4 cDNA Clone; EPHA4 cdna clone
Ordering
For Research Use Only!
Sequence
atgtgtgtacataggtgtgagtgtgtgtgtatgcgtgcctgtctgtgtgcgggtgtgtgtatgtgcatagcctcatgcttaggactacccatgaatgttgtggaatgctacacctggagagttctggttttccaccagtttcaagatgaagaactacatgatacagtggacctggagaccatccccttggaaagacaacccagagatgttcagcatcctgtatctacacgcatcctgtatctacacgtgtattttgtagctgtcacactaaccttaataagaattctacagctttggacagaggcattttcaccttaa
Sequence Length
318
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
104,507 Da
NCBI Official Full Name
Homo sapiens EPH receptor A4, mRNA
NCBI Official Synonym Full Names
EPH receptor A4
NCBI Official Symbol
EPHA4
NCBI Official Synonym Symbols
SEK; HEK8; TYRO1
NCBI Protein Information
ephrin type-A receptor 4
UniProt Protein Name
Ephrin type-A receptor 4
Protein Family
UniProt Gene Name
EPHA4
UniProt Synonym Gene Names
HEK8; SEK; TYRO1; EK8; hEK8
UniProt Entry Name
EPHA4_HUMAN

NCBI Description

This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2015]

Uniprot Description

EphA4: a tyrosine kinase receptor of the Eph family. Receptor for members of the ephrin-A family. Binds to ephrin-A1, -A4 and -A5. Binds more poorly to ephrin-A2 and -A3. May play a role in hindbrain pattern formation. The Eph receptor tyrosine kinase family, the largest in the tyrosine kinase group, has fourteen members. They bind membrane-anchored ligands, ephrins, at sites of cell-cell contact, regulating the repulsion and adhesion of cells that underlie the establishment, maintenance, and remodeling of patterns of cellular organization. Eph signals are particularly important in regulating cell adhesion and cell migration during development, axon guidance, homeostasis and disease. EphA receptors bind to GPI-anchored ephrin-A ligands, while EphB receptors bind to ephrin-B proteins that have a transmembrane and cytoplasmic domain. Interactions between EphB receptor kinases and ephrin-B proteins transduce signals bidirectionally, signaling to both interacting cell types. Eph receptors and ephrins also regulate the adhesion of endothelial cells and are required for the remodeling of blood vessels.

Protein type: Protein kinase, TK; EC 2.7.10.1; Kinase, protein; Membrane protein, integral; Protein kinase, tyrosine (receptor); TK group; Eph family

Chromosomal Location of Human Ortholog: 2q36.1

Cellular Component: axon; cytoplasm; dendrite; early endosome membrane; integral to plasma membrane; plasma membrane

Molecular Function: GPI-linked ephrin receptor activity; PH domain binding; protein binding; protein kinase activity; transmembrane-ephrin receptor activity

Biological Process: corticospinal tract morphogenesis; ephrin receptor signaling pathway; motor axon guidance; negative regulation of axon regeneration; peptidyl-tyrosine phosphorylation; protein amino acid autophosphorylation; regulation of astrocyte differentiation; regulation of axonogenesis; regulation of GTPase activity

Research Articles on EPHA4

Similar Products

Product Notes

The EPHA4 epha4 (Catalog #AAA1278523) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtgtgtac ataggtgtga gtgtgtgtgt atgcgtgcct gtctgtgtgc gggtgtgtgt atgtgcatag cctcatgctt aggactaccc atgaatgttg tggaatgcta cacctggaga gttctggttt tccaccagtt tcaagatgaa gaactacatg atacagtgga cctggagacc atccccttgg aaagacaacc cagagatgtt cagcatcctg tatctacacg catcctgtat ctacacgtgt attttgtagc tgtcacacta accttaataa gaattctaca gctttggaca gaggcatttt caccttaa. It is sometimes possible for the material contained within the vial of "EPHA4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.