Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

EHBP1 cdna clone

EHBP1 cDNA Clone

Gene Names
EHBP1; HPC12; NACSIN
Synonyms
EHBP1; EHBP1 cDNA Clone; EHBP1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcttcagtttggaagagactgcagcgtgtgggaaaacatgcatccaagttccagtttgtggcctcctaccaggagctcatggttgagtgtacgaagaaatggcaaccagataaactggtggtagtttggaccagaagaagccgaaggaagtcttctaaggcacatagctggcaacctggaataaaaaatccctatcgtggtgttgttgtgtggcctgttcctgaaaacattgaaatcactgtaacactttttaaggatcctcatgcggaagaatttgaagacaaagagtggacatttgtcatagaaaatgtaagctaa
Sequence Length
321
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
132,322 Da
NCBI Official Full Name
Homo sapiens EH domain binding protein 1, mRNA
NCBI Official Synonym Full Names
EH domain binding protein 1
NCBI Official Symbol
EHBP1
NCBI Official Synonym Symbols
HPC12; NACSIN
NCBI Protein Information
EH domain-binding protein 1
UniProt Protein Name
EH domain-binding protein 1
Protein Family
UniProt Gene Name
EHBP1
UniProt Synonym Gene Names
KIAA0903; NACSIN
UniProt Entry Name
EHBP1_HUMAN

NCBI Description

This gene encodes an Eps15 homology domain binding protein. The encoded protein may play a role in endocytic trafficking. A single nucleotide polymorphism in this gene is associated with an aggressive form of prostate cancer. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]

Uniprot Description

EHBP1: May play a role in actin reorganization. Links clathrin- mediated endocytosis to the actin cytoskeleton. Defects in EHBP1 are a cause of susceptibility to prostate cancer hereditary type 12 (HPC12). It is a condition associated with familial predisposition to cancer of the prostate. Most prostate cancers are adenocarcinomas that develop in the acini of the prostatic ducts. Other rare histopathologic types of prostate cancer that occur in approximately 5% of patients include small cell carcinoma, mucinous carcinoma, prostatic ductal carcinoma, transitional cell carcinoma, squamous cell carcinoma, basal cell carcinoma, adenoid cystic carcinoma (basaloid), signet-ring cell carcinoma and neuroendocrine carcinoma. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Vesicle

Chromosomal Location of Human Ortholog: 2p15

Cellular Component: cytoplasm; plasma membrane

Disease: Prostate Cancer, Hereditary, 12

Research Articles on EHBP1

Similar Products

Product Notes

The EHBP1 ehbp1 (Catalog #AAA1278852) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcttcag tttggaagag actgcagcgt gtgggaaaac atgcatccaa gttccagttt gtggcctcct accaggagct catggttgag tgtacgaaga aatggcaacc agataaactg gtggtagttt ggaccagaag aagccgaagg aagtcttcta aggcacatag ctggcaacct ggaataaaaa atccctatcg tggtgttgtt gtgtggcctg ttcctgaaaa cattgaaatc actgtaacac tttttaagga tcctcatgcg gaagaatttg aagacaaaga gtggacattt gtcatagaaa atgtaagcta a. It is sometimes possible for the material contained within the vial of "EHBP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.