Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ECSIT cdna clone

ECSIT cDNA Clone

Gene Names
ECSIT; SITPEC
Synonyms
ECSIT; ECSIT cDNA Clone; ECSIT cdna clone
Ordering
For Research Use Only!
Sequence
atgagctgggtccaggccaccctactggcccgaggcctctgtagggcctggggaggcacctgcggggccgccctcacaggaacctccatctctcaggtccctcgccggctccctcggggcctccactgcagcgcagctgcccatagctctgaacagtccctggttcccagcccaccggaaccccggcagaggcccaccaaggctctggtgccctttgaggacctgtttgggcaggcgcctggtggggaacgggacaaggcgagcttcctgcagacggtgcagaaatttgcggagcacagcgtgcgtaagcggggccacattgacttcatctacctggccctgcgcaagatgcgggagtatggtgtcgagcgggacctggctgtgtacaaccagctgctcaacatcttccccaaggaggtcttccggcctcgcaacatcatccagcgcatcttcgtccactaccctcggcagcaggagtgtgggattgctgtcctggagcagatggagaaccacggtgtgatgcccaacaaggagacggagttcctgctgattcagatctttggacgcaaaagctaccccatgctcaagttggtgcgcctgaagctgtggttccctcgattcatgaacgtcaaccccttcccagtgccccgggacctgccccaggaccctgtggagctggccatgtttggcctgcggcacatggagcctgaccttagtgccagggtcaccatctaccaggttcctttgcccaaagactcaacaggtgcagcagatcccccccagccccacatcgtaggaatccagagtcccgatcagcaggccgccctggcccgccacaatccagcccggcctgtctttgttgagggccccttctccctgtggctccgcaacaagtgtgtgtattaccacatcctcagagctgacttgctgcccccggaggagagggaagtggaagagacgccggaggagtggaacctctactacccgatgcagctggacctggagtatgtgaggagtggctgggacaactacgagtttgacatcaatgaagtggaggaaggccctgtcttcgccatgtgcatggcgggtgctcatgaccaggcgacgatggctaagtggatccagggcctgcaggagaccaacccaaccctggcccagatccccgtggtcttccgcctcgccgggtccacccgggagctccagacatcctctgcagggctggaggagccgcccctgcccgaggaccaccaggaagaagacgacaacctgcagcgacagcagcagggccagagctag
Sequence Length
1296
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
33,938 Da
NCBI Official Full Name
Homo sapiens ECSIT homolog (Drosophila), mRNA
NCBI Official Synonym Full Names
ECSIT signalling integrator
NCBI Official Symbol
ECSIT
NCBI Official Synonym Symbols
SITPEC
NCBI Protein Information
evolutionarily conserved signaling intermediate in Toll pathway, mitochondrial
UniProt Protein Name
Evolutionarily conserved signaling intermediate in Toll pathway, mitochondrial
UniProt Gene Name
ECSIT
UniProt Entry Name
ECSIT_HUMAN

Uniprot Description

ECSIT: Adapter protein of the Toll-like and IL-1 receptor signaling pathway that is involved in the activation of NF-kappa-B via MAP3K1. Promotes proteolytic activation of MAP3K1. Involved in the BMP signaling pathway. Required for normal embryonic development. Required for efficient assembly of mitochondrial NADH:ubiquinone oxidoreductase. Belongs to the ECSIT family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Transcription factor; Adaptor/scaffold

Chromosomal Location of Human Ortholog: 19p13.2

Cellular Component: cytoplasm; mitochondrial inner membrane; mitochondrion; nucleoplasm; nucleus

Molecular Function: oxidoreductase activity, acting on NADH or NADPH; protein binding

Biological Process: mitochondrial respiratory chain complex I assembly; regulation of oxidoreductase activity

Research Articles on ECSIT

Similar Products

Product Notes

The ECSIT ecsit (Catalog #AAA1277963) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagctggg tccaggccac cctactggcc cgaggcctct gtagggcctg gggaggcacc tgcggggccg ccctcacagg aacctccatc tctcaggtcc ctcgccggct ccctcggggc ctccactgca gcgcagctgc ccatagctct gaacagtccc tggttcccag cccaccggaa ccccggcaga ggcccaccaa ggctctggtg ccctttgagg acctgtttgg gcaggcgcct ggtggggaac gggacaaggc gagcttcctg cagacggtgc agaaatttgc ggagcacagc gtgcgtaagc ggggccacat tgacttcatc tacctggccc tgcgcaagat gcgggagtat ggtgtcgagc gggacctggc tgtgtacaac cagctgctca acatcttccc caaggaggtc ttccggcctc gcaacatcat ccagcgcatc ttcgtccact accctcggca gcaggagtgt gggattgctg tcctggagca gatggagaac cacggtgtga tgcccaacaa ggagacggag ttcctgctga ttcagatctt tggacgcaaa agctacccca tgctcaagtt ggtgcgcctg aagctgtggt tccctcgatt catgaacgtc aaccccttcc cagtgccccg ggacctgccc caggaccctg tggagctggc catgtttggc ctgcggcaca tggagcctga ccttagtgcc agggtcacca tctaccaggt tcctttgccc aaagactcaa caggtgcagc agatcccccc cagccccaca tcgtaggaat ccagagtccc gatcagcagg ccgccctggc ccgccacaat ccagcccggc ctgtctttgt tgagggcccc ttctccctgt ggctccgcaa caagtgtgtg tattaccaca tcctcagagc tgacttgctg cccccggagg agagggaagt ggaagagacg ccggaggagt ggaacctcta ctacccgatg cagctggacc tggagtatgt gaggagtggc tgggacaact acgagtttga catcaatgaa gtggaggaag gccctgtctt cgccatgtgc atggcgggtg ctcatgacca ggcgacgatg gctaagtgga tccagggcct gcaggagacc aacccaaccc tggcccagat ccccgtggtc ttccgcctcg ccgggtccac ccgggagctc cagacatcct ctgcagggct ggaggagccg cccctgcccg aggaccacca ggaagaagac gacaacctgc agcgacagca gcagggccag agctag. It is sometimes possible for the material contained within the vial of "ECSIT, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.