Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DPF2 cdna clone

DPF2 cDNA Clone

Gene Names
DPF2; REQ; UBID4; ubi-d4
Synonyms
DPF2; DPF2 cDNA Clone; DPF2 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggctgtggtggagaatgtagtgaagctccttggggagcagtactacaaagatgccatggagcagtgccacaattacaatgctcgcctctgtgctgagcgcagcgtgcgcctgcctttcttggactcacagaccggagtagcccagagcaattgttacatctggatggaaaagcgacaccggggtccaggattggcctccggacagctgtactcctaccctgcccggcgctggcggaaaaagcggcgagcccatccccctgaggatccacgactttccttcccatctattaagccagacacagaccagaccctgaagaaggaggggctgatctctcaggatggcagtagtttagaggctctgttgcgcactgaccccctggagaagcgaggtgccccggatccccgagttgatgatgacagcctgggcgagtttcctgtgaccaacagtcgagcgcgaaagcggatcctagaaccagatgacttcctggatgacctcgatgatgaagactatgaagaagatactcccaagcgtcggggaaaggggaaatccaagggtaagggtgtgggcagtgcccgtaagaagctggatgcttccatcctggaggaccgggataagccctatgcctgtgacatttgtggaaaacgttacaagaaccgaccaggcctcagttaccactatgcccactcccacttggctgaggaggagggcgaggacaaggaagactctcaaccacccactcctgtttcccagaggtctgaggagcagaaatccaaaaagggtcctgatggattggccttgcccaacaactactgtgacttctgcctgggggactcaaagattaacaagaagacgggacaacccgaggagctggtgtcctgttctgactgtggccgctcagggcatccatcttgcctccaatttacccccgtgatgatggcggcagtgaagacataccgctggcagtgcatcgagtgcaaatgttgcaatatctgcggcacctccgagaatgacgaccagttgctcttctgtgatgactgcgatcgtggctaccacatgtactgtctcaccccgtccatgtctgagccccctgaaggaagttggagctgccacctgtgtctggacctgttgaaagagaaagcttccatctaccagaaccagaactcctcttga
Sequence Length
1176
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
23,599 Da
NCBI Official Full Name
Homo sapiens D4, zinc and double PHD fingers family 2, mRNA
NCBI Official Synonym Full Names
double PHD fingers 2
NCBI Official Symbol
DPF2
NCBI Official Synonym Symbols
REQ; UBID4; ubi-d4
NCBI Protein Information
zinc finger protein ubi-d4
UniProt Protein Name
Zinc finger protein ubi-d4
Protein Family
UniProt Gene Name
DPF2
UniProt Synonym Gene Names
BAF45D; REQ; UBID4; BAF45D
UniProt Entry Name
REQU_HUMAN

NCBI Description

The protein encoded by this gene is a member of the d4 domain family, characterized by a zinc finger-like structural motif. This protein functions as a transcription factor which is necessary for the apoptotic response following deprivation of survival factors. It likely serves a regulatory role in rapid hematopoietic cell growth and turnover. This gene is considered a candidate gene for multiple endocrine neoplasia type I, an inherited cancer syndrome involving multiple parathyroid, enteropancreatic, and pituitary tumors. [provided by RefSeq, Jul 2008]

Uniprot Description

requiem: May be a transcription factor required for the apoptosis response following survival factor withdrawal from myeloid cells. Might also have a role in the development and maturation of lymphoid cells. Belongs to the requiem/DPF family.

Protein type: Apoptosis; C2H2-type zinc finger protein

Chromosomal Location of Human Ortholog: 11q13

Cellular Component: centrosome; cytoplasm; intracellular membrane-bound organelle; nuclear chromatin; nucleoplasm

Molecular Function: protein binding

Biological Process: apoptosis

Research Articles on DPF2

Similar Products

Product Notes

The DPF2 dpf2 (Catalog #AAA1268550) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggctg tggtggagaa tgtagtgaag ctccttgggg agcagtacta caaagatgcc atggagcagt gccacaatta caatgctcgc ctctgtgctg agcgcagcgt gcgcctgcct ttcttggact cacagaccgg agtagcccag agcaattgtt acatctggat ggaaaagcga caccggggtc caggattggc ctccggacag ctgtactcct accctgcccg gcgctggcgg aaaaagcggc gagcccatcc ccctgaggat ccacgacttt ccttcccatc tattaagcca gacacagacc agaccctgaa gaaggagggg ctgatctctc aggatggcag tagtttagag gctctgttgc gcactgaccc cctggagaag cgaggtgccc cggatccccg agttgatgat gacagcctgg gcgagtttcc tgtgaccaac agtcgagcgc gaaagcggat cctagaacca gatgacttcc tggatgacct cgatgatgaa gactatgaag aagatactcc caagcgtcgg ggaaagggga aatccaaggg taagggtgtg ggcagtgccc gtaagaagct ggatgcttcc atcctggagg accgggataa gccctatgcc tgtgacattt gtggaaaacg ttacaagaac cgaccaggcc tcagttacca ctatgcccac tcccacttgg ctgaggagga gggcgaggac aaggaagact ctcaaccacc cactcctgtt tcccagaggt ctgaggagca gaaatccaaa aagggtcctg atggattggc cttgcccaac aactactgtg acttctgcct gggggactca aagattaaca agaagacggg acaacccgag gagctggtgt cctgttctga ctgtggccgc tcagggcatc catcttgcct ccaatttacc cccgtgatga tggcggcagt gaagacatac cgctggcagt gcatcgagtg caaatgttgc aatatctgcg gcacctccga gaatgacgac cagttgctct tctgtgatga ctgcgatcgt ggctaccaca tgtactgtct caccccgtcc atgtctgagc cccctgaagg aagttggagc tgccacctgt gtctggacct gttgaaagag aaagcttcca tctaccagaa ccagaactcc tcttga. It is sometimes possible for the material contained within the vial of "DPF2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.