Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DNAJC3 cdna clone

DNAJC3 cDNA Clone

Gene Names
DNAJC3; P58; HP58; ACPHD; ERdj6; PRKRI; P58IPK
Synonyms
DNAJC3; DNAJC3 cDNA Clone; DNAJC3 cdna clone
Ordering
For Research Use Only!
Sequence
atggtggcccccggctccgtgaccagccggctgggctcggtattccccttcctgctagtcctggtggatctgcagtacgaaggtgctgaatgtggagtaaatgcagatgttgagaaacatcttgaattgggcaagaaattacttgcagctggacagctagctgatgctttatctcagtttcatgctgccgtagatggtgaccctgataactatattgcttattatcggagggctactgtctttttagctatgggcaaatcaaaagctgcacttcctgatttaactaaagtgattcaattgaagatggacttcactgcagcaagattacagagaggtcacttattactcaaacaaggaaaacttgatgaagcagaagatgattttaaaaaagtggtgtttcctgttccttctctgttgggactccagcgttctctcctagatgatctatacttgctattttggttcttccttatgaagaaggtgactttcagatgcctctcgtcagccatctctgaatgccttcctcagtctttaaatttgatgaagttcaatttgttgatttcctttttacttctgtggactgtgcgtttggtgtcatgtctaagaagtattcactacgccgtaggatctaaaacttttctcatatcttctaaaagttttatggttttgtgttttatttttaagcccatagtctatttgagttaa
Sequence Length
705
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
57,580 Da
NCBI Official Full Name
Homo sapiens DnaJ (Hsp40) homolog, subfamily C, member 3, mRNA
NCBI Official Synonym Full Names
DnaJ heat shock protein family (Hsp40) member C3
NCBI Official Symbol
DNAJC3
NCBI Official Synonym Symbols
P58; HP58; ACPHD; ERdj6; PRKRI; P58IPK
NCBI Protein Information
dnaJ homolog subfamily C member 3
UniProt Protein Name
DnaJ homolog subfamily C member 3
Protein Family
UniProt Gene Name
DNAJC3
UniProt Synonym Gene Names
P58IPK; PRKRI; ER-resident protein ERdj6; ERdj6; Protein kinase inhibitor p58
UniProt Entry Name
DNJC3_HUMAN

NCBI Description

This gene encodes a protein with multiple tetratricopeptide repeat (TPR) motifs as well as the highly conserved J domain found in DNAJ chaperone family members. It is a member of the tetratricopeptide repeat family of proteins and acts as an inhibitor of the interferon-induced, dsRNA-activated protein kinase (PKR). [provided by RefSeq, Jul 2010]

Uniprot Description

DNAJC3: Involved in the unfolded protein response (UPR) during ER stress. Co-chaperone of HSPA8/HSC70, it stimulates its ATPase activity. May inhibit both the autophosphorylation of EIF2AK2/PKR and the ability of EIF2AK2 to catalyze phosphorylation of the EIF2A. May inhibit EIF2AK3/PERK activity. Interacts with EIF2AK3 and EIF2AK2. Forms a trimeric complex with DNAJB1 and HSPA8. Interacts with PRKRIR/P52RIPK. Up-regulated during an endoplasmic reticulum stress via ATF6. Activated in response to infection by influenza virus through the dissociation of DNAJB1. Down-regulated by DNAJB1 and PRKRIR/P52RIPK. Widely expressed with high level in the pancreas and testis. Also expressed in cell lines with different levels.

Protein type: Endoplasmic reticulum; Inhibitor; Chaperone; Protein kinase, regulatory subunit

Chromosomal Location of Human Ortholog: 13q32.1

Cellular Component: cytoplasm; cytosol; endoplasmic reticulum; endoplasmic reticulum lumen; membrane

Molecular Function: protein kinase binding; protein kinase inhibitor activity

Biological Process: negative regulation of apoptosis

Disease: Ataxia, Combined Cerebellar And Peripheral, With Hearing Loss And Diabetes Mellitus

Research Articles on DNAJC3

Similar Products

Product Notes

The DNAJC3 dnajc3 (Catalog #AAA1266007) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtggccc ccggctccgt gaccagccgg ctgggctcgg tattcccctt cctgctagtc ctggtggatc tgcagtacga aggtgctgaa tgtggagtaa atgcagatgt tgagaaacat cttgaattgg gcaagaaatt acttgcagct ggacagctag ctgatgcttt atctcagttt catgctgccg tagatggtga ccctgataac tatattgctt attatcggag ggctactgtc tttttagcta tgggcaaatc aaaagctgca cttcctgatt taactaaagt gattcaattg aagatggact tcactgcagc aagattacag agaggtcact tattactcaa acaaggaaaa cttgatgaag cagaagatga ttttaaaaaa gtggtgtttc ctgttccttc tctgttggga ctccagcgtt ctctcctaga tgatctatac ttgctatttt ggttcttcct tatgaagaag gtgactttca gatgcctctc gtcagccatc tctgaatgcc ttcctcagtc tttaaatttg atgaagttca atttgttgat ttccttttta cttctgtgga ctgtgcgttt ggtgtcatgt ctaagaagta ttcactacgc cgtaggatct aaaacttttc tcatatcttc taaaagtttt atggttttgt gttttatttt taagcccata gtctatttga gttaa. It is sometimes possible for the material contained within the vial of "DNAJC3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.