Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DNAJC10 cdna clone

DNAJC10 cDNA Clone

Gene Names
DNAJC10; JPDI; MTHr; ERdj5; PDIA19
Synonyms
DNAJC10; DNAJC10 cDNA Clone; DNAJC10 cdna clone
Ordering
For Research Use Only!
Sequence
atgggagtctggttaaataaagatgactatatcagagacttgaaaaggatcattctctgttttctgatagtgtatatggccattttagtgggcacagatcaggatttttacagtttacttggagtgtccaaaactgcaagcagtagagaaataagacaagctttcaagaaattggcattgaagttacatcctgataaaaacccgaataacccaaatgcacatggcgattttttaaaaataaatagagcatatgaagtactcaaagatgaagatctacggaaaaagtatgacaaatatggagaaaagggacttgaggataatcaaggtggccagtatgaaagctggaactattatcgttatgattttggtatttatgatgatgatcctgaaatcataacattggaaagaagagaatttgatgctgctgttaattctggagaactgtggtttgtaaatttttactccccaggctgttcacactgccatgatttagctcccacatggagagactttgctaaagaagtggatgggttacttcgaattggagctgttaactgtggtgatgatagaatgctttgccgaatgaaaggagtcaacagctatcccagtctcttcatttttcggtctggaatggccccagtgaaatatcatggagacagatcaaaggagagtttagtgagttttgcaatgcagcatgttagaagtacagtgacagaactttggacaggaaattttgtcaactccatacaaactgcttttgctgctggtattggctggctgatcactttttgttcaaaaggaggagattgtttgacttcacagacacgactcaggcttagtggcatgttggatggtcttgttaatgtaggatggatggactgtgccacccaggataacctttgtaaaagcttagatattacaacaagtactactgcttattttcctcctggagccactttaaataacaaagagaaaaacagtattttgtttctcaactcattggatgctaaagaaatatatttggaagtaatacataatcttccagattttgaactactttcggcaaacacactagaggatcgtttggctcatcatcggtggctgttattttttcattttggaaaaaatgaaaattcaaatgatcctgagctgaaaaaactaaaaactctacttaaaaatgatcatattcaagttggcaggtttgactgttcctctgcaccagacatctgtagtaatctgtatgtttttcagccgtctctagcagtatttaaaggacaaggaaccaaagaatatgaaattcatcatggaaagaagattctatatgatatacttgcctttgccaaagaaagtgtgaattctcatgttaccacgcttggacctcaaaattttcctgccaatgacaaagaaccatggcttgttgatttctttgccccctggtgtccaccatgtcgagctttactaccagagttacgaagagcatcaaatcttctttatggtcagcttaagtttggtacactagattgtacagttcatgagggactctgtaacatgtataacattcaggcttatccaacaacagtggtattcaaccagtccaacattcatgagtatgaaggacatcactctgctgaacaaatcttggagttcatagaggatcttatgaatccttcagtggtctcccttacacccaccaccttcaacgaactagttacacaaagaaaacacaacgaagtctggatggttgatttctattctccgtggtgtcatccttgccaagtcttaatgccagaatggaaaagaatggcccggacattaactggactgatcaacgtgggcagtatagattgccaacagtatcattctttttgtgcccaggaaaacgttcaaagataccctgagataagattttttcccccaaaatcaaataaagcttatcagtatcacagttacaatggttggaatagggatgcttattccctgagaatctggggtctaggatttttacctcaagtatccacagatctaacacctcagactttcagtgaaaaagttctacaagggaaaaatcattgggtgattgatttctatgctccttggtgtggaccttgccagaattttgctccagaatttgagctcttggctaggatgattaaaggaaaagtgaaagctggaaaagtagactgtcaggcttatgctcagacatgccagaaagctgggatcagggcctatccaactgttaagttttatttctacgaaagagcaaagagaaattttcaagaagagcagataaataccagagatgcaaaagcaatcgctgccttaataagtgaaaaattggaaactctccgaaatcaaggcaagaggaataaggatgaactttga
Sequence Length
2382
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
37,682 Da
NCBI Official Full Name
Homo sapiens DnaJ (Hsp40) homolog, subfamily C, member 10, mRNA
NCBI Official Synonym Full Names
DnaJ heat shock protein family (Hsp40) member C10
NCBI Official Symbol
DNAJC10
NCBI Official Synonym Symbols
JPDI; MTHr; ERdj5; PDIA19
NCBI Protein Information
dnaJ homolog subfamily C member 10
UniProt Protein Name
DnaJ homolog subfamily C member 10
Protein Family
UniProt Gene Name
DNAJC10
UniProt Synonym Gene Names
ERDJ5; ER-resident protein ERdj5; ERdj5; MTHr
UniProt Entry Name
DJC10_HUMAN

NCBI Description

This gene encodes an endoplasmic reticulum co-chaperone which is part of the endoplasmic reticulum-associated degradation complex involved in recognizing and degrading misfolded proteins. The encoded protein reduces incorrect disulfide bonds in misfolded glycoproteins. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2012]

Uniprot Description

DNAJC10: This endoplasmic reticulum co-chaperone may play a role in protein folding and translocation across the endoplasmic reticulum membrane. May act as a co-chaperone for HSPA5. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Chaperone; Secreted, signal peptide; Endoplasmic reticulum; Secreted

Chromosomal Location of Human Ortholog: 2q32.1

Cellular Component: endoplasmic reticulum; endoplasmic reticulum lumen; membrane

Molecular Function: ATPase activator activity; ATPase binding; chaperone binding; disulfide oxidoreductase activity; Hsp70 protein binding; misfolded protein binding; oxidoreductase activity, acting on sulfur group of donors, disulfide as acceptor; protein binding; protein disulfide oxidoreductase activity

Biological Process: ER-associated protein catabolic process; negative regulation of protein amino acid phosphorylation; positive regulation of ATPase activity

Research Articles on DNAJC10

Similar Products

Product Notes

The DNAJC10 dnajc10 (Catalog #AAA1267436) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggagtct ggttaaataa agatgactat atcagagact tgaaaaggat cattctctgt tttctgatag tgtatatggc cattttagtg ggcacagatc aggattttta cagtttactt ggagtgtcca aaactgcaag cagtagagaa ataagacaag ctttcaagaa attggcattg aagttacatc ctgataaaaa cccgaataac ccaaatgcac atggcgattt tttaaaaata aatagagcat atgaagtact caaagatgaa gatctacgga aaaagtatga caaatatgga gaaaagggac ttgaggataa tcaaggtggc cagtatgaaa gctggaacta ttatcgttat gattttggta tttatgatga tgatcctgaa atcataacat tggaaagaag agaatttgat gctgctgtta attctggaga actgtggttt gtaaattttt actccccagg ctgttcacac tgccatgatt tagctcccac atggagagac tttgctaaag aagtggatgg gttacttcga attggagctg ttaactgtgg tgatgataga atgctttgcc gaatgaaagg agtcaacagc tatcccagtc tcttcatttt tcggtctgga atggccccag tgaaatatca tggagacaga tcaaaggaga gtttagtgag ttttgcaatg cagcatgtta gaagtacagt gacagaactt tggacaggaa attttgtcaa ctccatacaa actgcttttg ctgctggtat tggctggctg atcacttttt gttcaaaagg aggagattgt ttgacttcac agacacgact caggcttagt ggcatgttgg atggtcttgt taatgtagga tggatggact gtgccaccca ggataacctt tgtaaaagct tagatattac aacaagtact actgcttatt ttcctcctgg agccacttta aataacaaag agaaaaacag tattttgttt ctcaactcat tggatgctaa agaaatatat ttggaagtaa tacataatct tccagatttt gaactacttt cggcaaacac actagaggat cgtttggctc atcatcggtg gctgttattt tttcattttg gaaaaaatga aaattcaaat gatcctgagc tgaaaaaact aaaaactcta cttaaaaatg atcatattca agttggcagg tttgactgtt cctctgcacc agacatctgt agtaatctgt atgtttttca gccgtctcta gcagtattta aaggacaagg aaccaaagaa tatgaaattc atcatggaaa gaagattcta tatgatatac ttgcctttgc caaagaaagt gtgaattctc atgttaccac gcttggacct caaaattttc ctgccaatga caaagaacca tggcttgttg atttctttgc cccctggtgt ccaccatgtc gagctttact accagagtta cgaagagcat caaatcttct ttatggtcag cttaagtttg gtacactaga ttgtacagtt catgagggac tctgtaacat gtataacatt caggcttatc caacaacagt ggtattcaac cagtccaaca ttcatgagta tgaaggacat cactctgctg aacaaatctt ggagttcata gaggatctta tgaatccttc agtggtctcc cttacaccca ccaccttcaa cgaactagtt acacaaagaa aacacaacga agtctggatg gttgatttct attctccgtg gtgtcatcct tgccaagtct taatgccaga atggaaaaga atggcccgga cattaactgg actgatcaac gtgggcagta tagattgcca acagtatcat tctttttgtg cccaggaaaa cgttcaaaga taccctgaga taagattttt tcccccaaaa tcaaataaag cttatcagta tcacagttac aatggttgga atagggatgc ttattccctg agaatctggg gtctaggatt tttacctcaa gtatccacag atctaacacc tcagactttc agtgaaaaag ttctacaagg gaaaaatcat tgggtgattg atttctatgc tccttggtgt ggaccttgcc agaattttgc tccagaattt gagctcttgg ctaggatgat taaaggaaaa gtgaaagctg gaaaagtaga ctgtcaggct tatgctcaga catgccagaa agctgggatc agggcctatc caactgttaa gttttatttc tacgaaagag caaagagaaa ttttcaagaa gagcagataa ataccagaga tgcaaaagca atcgctgcct taataagtga aaaattggaa actctccgaa atcaaggcaa gaggaataag gatgaacttt ga. It is sometimes possible for the material contained within the vial of "DNAJC10, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.